ID: 1165461119

View in Genome Browser
Species Human (GRCh38)
Location 19:35944955-35944977
Sequence GTCCAGCTGGACCACGGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461119_1165461126 -8 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461126 19:35944970-35944992 AGCTGGACTGCGAGCCCTGGGGG 0: 1
1: 0
2: 4
3: 21
4: 154
1165461119_1165461124 -10 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461119_1165461130 11 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1165461119_1165461131 12 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461131 19:35944990-35945012 GGGCCCGGCCACGAACCTGTGGG 0: 1
1: 0
2: 1
3: 7
4: 69
1165461119_1165461127 -3 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461119_1165461125 -9 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461119_1165461135 24 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461119 Original CRISPR GTCCAGCTGGACCACGGTGT GGG (reversed) Exonic
906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG + Intergenic
912119578 1:106453975-106453997 TTTCATCTGGACCACGGTTTGGG + Intergenic
915292627 1:154896906-154896928 GTCCAGCTGGAGAGCTGTGTGGG + Intergenic
920574687 1:207050820-207050842 GTCCAGCCGGACCCGGGTGCGGG - Exonic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
1064167696 10:13001217-13001239 GTAGTCCTGGACCACGGTGTGGG + Exonic
1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1075572357 10:123555625-123555647 GTCCACCTGGCCCACGGTTGGGG - Intergenic
1076687115 10:132203160-132203182 GCCCAGTTGGACCTCAGTGTGGG + Intronic
1078638029 11:13069844-13069866 ATCCAGATGGACCACGTTGGGGG - Intergenic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1082804424 11:57438517-57438539 GTCCAGCTGCTCCACGGTTGAGG - Intergenic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1084323522 11:68386388-68386410 GTCCACCTGCAGCACGATGTCGG - Exonic
1089582346 11:119489300-119489322 GTCCTGATGGACCAGGGTGGGGG + Intergenic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1100218869 12:92482354-92482376 GTCTTGCTGGACCAGGGTCTTGG - Intergenic
1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG + Intronic
1103761347 12:123252477-123252499 TACCAGTTGGACCACGTTGTTGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1114535540 14:23419959-23419981 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1114613641 14:24057192-24057214 GTCCAGGTGCACCAGGGCGTTGG - Exonic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119296498 14:73537582-73537604 GTCCAGCTCGCCAAGGGTGTCGG - Exonic
1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG + Exonic
1121637892 14:95466123-95466145 GCCCAGCTGGAGCTCGATGTGGG + Exonic
1122018575 14:98817920-98817942 GTCCAGCTGGTCCATGGACTGGG - Intergenic
1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG + Intronic
1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG + Intergenic
1128747390 15:70124085-70124107 CCCCAGCTGGACCACTGTGAGGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1133818612 16:9216721-9216743 GTCTGGCTGGACCAAGGAGTTGG + Intergenic
1135194910 16:20386410-20386432 CTCCAGATGGACCACGGGGGTGG - Intronic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1142210943 16:88808187-88808209 GTCCAGCTTGACGTAGGTGTCGG - Exonic
1148131767 17:45266576-45266598 CTCCAGCTGGAACATGGTGCTGG - Exonic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1152234454 17:79131383-79131405 GTTCAGCTGGAAGACGGTGAAGG - Intronic
1156545806 18:37962621-37962643 GTCCGGGTGGAGCACCGTGTAGG - Intergenic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1160704758 19:524727-524749 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704779 19:524782-524804 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704821 19:524894-524916 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161488874 19:4550821-4550843 GTCCATCTGGACGCCGGTGCCGG - Exonic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165229456 19:34377826-34377848 GTTCAGCTGGGCCAGGGTTTTGG - Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166144829 19:40826575-40826597 GTCCAGCAGGGGCAGGGTGTGGG - Intronic
1166182913 19:41121632-41121654 GTCCAGCAGGGGCAGGGTGTGGG + Intronic
926035049 2:9630158-9630180 ATCCATCTGCACCACGGTGCTGG - Exonic
927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG + Intronic
928444542 2:31321229-31321251 GACCAGGTGGACCACGGTGGTGG - Intergenic
931069254 2:58626022-58626044 GTCCACCTGGACCACGAAGCAGG - Intergenic
932304475 2:70692117-70692139 GTCCTGTTGGACCAAGGCGTGGG - Intronic
934725664 2:96616770-96616792 ATGCTGCTGGGCCACGGTGTGGG - Intronic
938682221 2:133703438-133703460 GACTAGCTGGTCCACTGTGTAGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG + Intronic
947749881 2:232526436-232526458 GTCCTGCTGGACCATGAGGTTGG - Intronic
948923701 2:241080855-241080877 GTCCAGGGTGACCACGGGGTAGG + Intronic
1170802621 20:19602935-19602957 GCTCAGCTGAACCACGGTGCGGG - Intronic
1172812220 20:37656736-37656758 GCGCAGCTGGTCCATGGTGTGGG - Intergenic
1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG + Intergenic
1174182064 20:48681196-48681218 GCCCAGCTGGGCCAAGGGGTGGG - Intronic
1177884704 21:26733624-26733646 TTCCACCTGGACCATGGTATAGG + Intergenic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1184786892 22:46676363-46676385 GGCCAGCTGGCCGACGGTCTGGG + Intronic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
949555397 3:5148173-5148195 GTCCAGCTGGACCAATTCGTAGG - Intronic
953304692 3:41817129-41817151 GTTCATTTGGACCACTGTGTAGG - Intronic
964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG + Exonic
975784936 4:77877643-77877665 GTGCAGCTGGACCTTGGGGTTGG + Intronic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG + Intergenic
985538547 5:477379-477401 GTCCACGTTGACCACGTTGTCGG + Exonic
989256302 5:39369294-39369316 CTCCAGCAAGACCATGGTGTGGG - Intronic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
1002932399 6:1643634-1643656 GACCACCTGGGCCACGGTGGGGG + Intronic
1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG + Intergenic
1005913360 6:30329727-30329749 GTCCAGTGGCACAACGGTGTGGG - Exonic
1006772029 6:36561661-36561683 GTACAGCTGGAGCAAGTTGTGGG - Intergenic
1013304925 6:108838954-108838976 GTCCATCTGGGTCACGGAGTGGG - Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG + Intronic
1028303229 7:89228715-89228737 CTCCACCTGCACCCCGGTGTGGG - Intronic
1032534426 7:132650063-132650085 GAGCAGCTGGACCCAGGTGTTGG - Intronic
1039984962 8:42439369-42439391 GACCAGCTGGGCCTGGGTGTGGG - Intronic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1047995119 8:130327346-130327368 CTCCAACTGGACCTCAGTGTAGG + Intronic
1052577119 9:30304713-30304735 GTCTAACTGGACCACAGTTTTGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG + Intergenic
1062453993 9:136627191-136627213 GCCCAGCTGGAGCACGGGGAGGG + Intergenic
1190051979 X:47157253-47157275 GGGCCTCTGGACCACGGTGTAGG + Intronic
1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG + Intergenic
1201385187 Y:13432655-13432677 TTCCAGGTGGACCACGTGGTGGG - Intronic