ID: 1165461119

View in Genome Browser
Species Human (GRCh38)
Location 19:35944955-35944977
Sequence GTCCAGCTGGACCACGGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461119_1165461131 12 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461131 19:35944990-35945012 GGGCCCGGCCACGAACCTGTGGG 0: 1
1: 0
2: 1
3: 7
4: 69
1165461119_1165461124 -10 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461119_1165461135 24 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1165461119_1165461126 -8 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461126 19:35944970-35944992 AGCTGGACTGCGAGCCCTGGGGG 0: 1
1: 0
2: 4
3: 21
4: 154
1165461119_1165461130 11 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1165461119_1165461127 -3 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461119_1165461125 -9 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461119 Original CRISPR GTCCAGCTGGACCACGGTGT GGG (reversed) Exonic