ID: 1165461122

View in Genome Browser
Species Human (GRCh38)
Location 19:35944967-35944989
Sequence TCCAGCTGGACTGCGAGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 206}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461105_1165461122 21 Left 1165461105 19:35944923-35944945 CCCGCCCGCCCCGGAGCCCGCGG 0: 2
1: 0
2: 7
3: 78
4: 536
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461109_1165461122 16 Left 1165461109 19:35944928-35944950 CCGCCCCGGAGCCCGCGGCGCTC 0: 1
1: 0
2: 2
3: 26
4: 266
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461112_1165461122 12 Left 1165461112 19:35944932-35944954 CCCGGAGCCCGCGGCGCTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461115_1165461122 5 Left 1165461115 19:35944939-35944961 CCCGCGGCGCTCAGGGCCCACAC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461104_1165461122 22 Left 1165461104 19:35944922-35944944 CCCCGCCCGCCCCGGAGCCCGCG 0: 1
1: 0
2: 8
3: 97
4: 706
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461110_1165461122 13 Left 1165461110 19:35944931-35944953 CCCCGGAGCCCGCGGCGCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461114_1165461122 11 Left 1165461114 19:35944933-35944955 CCGGAGCCCGCGGCGCTCAGGGC 0: 1
1: 0
2: 0
3: 18
4: 221
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461108_1165461122 17 Left 1165461108 19:35944927-35944949 CCCGCCCCGGAGCCCGCGGCGCT 0: 1
1: 0
2: 6
3: 29
4: 336
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461116_1165461122 4 Left 1165461116 19:35944940-35944962 CCGCGGCGCTCAGGGCCCACACC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461102_1165461122 26 Left 1165461102 19:35944918-35944940 CCCGCCCCGCCCGCCCCGGAGCC 0: 1
1: 1
2: 19
3: 164
4: 1250
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461103_1165461122 25 Left 1165461103 19:35944919-35944941 CCGCCCCGCCCGCCCCGGAGCCC 0: 1
1: 1
2: 15
3: 183
4: 1599
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1165461107_1165461122 20 Left 1165461107 19:35944924-35944946 CCGCCCGCCCCGGAGCCCGCGGC 0: 1
1: 1
2: 6
3: 73
4: 563
Right 1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461122 Original CRISPR TCCAGCTGGACTGCGAGCCC TGG Exonic
900311421 1:2035283-2035305 GCCAGCAGGACTGCGGGCCAGGG - Intergenic
900408316 1:2502059-2502081 TGCAGCTGGGCTGGGACCCCTGG + Intronic
901678451 1:10900115-10900137 TCCCCCAGGACTGCGAGGCCGGG - Intergenic
902214161 1:14924197-14924219 TCCGGCCGGACTGAGAGCCCTGG + Intronic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
906136768 1:43505535-43505557 TCCAGCCGGACTGCCTGCCCTGG - Intergenic
906670771 1:47652931-47652953 TCCTGCTGGACTGTGCTCCCTGG - Intergenic
912261183 1:108112722-108112744 TCCAGCTTGACTGGGATCCTTGG - Intergenic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
916667220 1:166976930-166976952 CCCAGCTGGAATGCAGGCCCGGG + Intronic
920038018 1:203077996-203078018 TCCTTCTGGACTGGGTGCCCTGG - Exonic
920048008 1:203146049-203146071 TCCAGCTCCTCTGGGAGCCCAGG + Intronic
920197821 1:204241324-204241346 CTGAGCTGGGCTGCGAGCCCAGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923260745 1:232265709-232265731 CCCAGCTGGGCTGAGAGCTCTGG - Intergenic
924054715 1:240113786-240113808 TCCAGCTGGAGTGTGTGTCCTGG + Intronic
1063208693 10:3858642-3858664 TGCAGCTGCAGTGTGAGCCCAGG + Intergenic
1063610908 10:7561339-7561361 CCCAGCTGGACAGACAGCCCTGG - Exonic
1065256803 10:23877971-23877993 TTCAGCTGAACTGTGTGCCCCGG - Intronic
1067145607 10:43691631-43691653 TCCAGATGGATGGCAAGCCCAGG - Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069949220 10:72007921-72007943 TCCAGCTGGTGCGCGACCCCCGG + Exonic
1070156412 10:73838316-73838338 TACACCTGGACTGCCTGCCCTGG + Intronic
1070450070 10:76549138-76549160 TTCAGCTGCCCTGGGAGCCCAGG + Intronic
1073461247 10:103667155-103667177 CCCAGCCAGACTGCGAGTCCAGG - Intronic
1074879764 10:117646881-117646903 TCCACCTGGCCTGGGAGCCCGGG + Intergenic
1076776850 10:132702789-132702811 TCCAGCAGGACTGAGACCCATGG + Intronic
1076876349 10:133218085-133218107 TCCAGCTGGACGCCATGCCCCGG - Intronic
1077067429 11:648547-648569 TCCAGCCGGACCTCCAGCCCAGG - Intronic
1077204129 11:1333573-1333595 TCCTGCTGCACTGCTGGCCCCGG - Intergenic
1077499720 11:2903687-2903709 TCCAGCTTCAGTGCCAGCCCCGG + Exonic
1078143678 11:8709043-8709065 TCCAGCAGGACTCAGAGGCCTGG + Intronic
1084007470 11:66331025-66331047 TGCTGCTGGACTGCAAGGCCCGG + Intronic
1084440033 11:69167551-69167573 TCCAGCTGGTCTTCGGGCCTGGG - Intergenic
1084632138 11:70359984-70360006 CCCACCTGGAGTGCCAGCCCAGG + Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1088342910 11:108789043-108789065 CCCTGCTGGTCTGTGAGCCCAGG + Intronic
1088582154 11:111326849-111326871 TCCAACTGGACAGCCAGCTCAGG + Intergenic
1092140344 12:6179287-6179309 TCCTGCTGGACTGGAAGTCCGGG - Intergenic
1092457935 12:8661206-8661228 TCCAGCTCCACTGAGAGGCCTGG + Intronic
1092908383 12:13123181-13123203 TCCTGATGGAATGCTAGCCCTGG + Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1103713500 12:122929817-122929839 CCCAGCTGCCCTCCGAGCCCAGG - Exonic
1105798787 13:23884517-23884539 TGCAGCTGGGCTGCCAGCCCAGG - Intronic
1106675428 13:31953114-31953136 TCCTGCTGGACTTCAAGCCTTGG + Intergenic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1107688523 13:42928405-42928427 TCCAACTGGACTAAGAACCCTGG + Intronic
1112563507 13:100533569-100533591 TCCAGCTGCAGTGAGAACCCAGG + Exonic
1113888599 13:113724894-113724916 TCCAGGTGGACTCCGAGGCCAGG + Intronic
1115956067 14:38780862-38780884 TCTAGCTGTACTGGCAGCCCAGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116888818 14:50247228-50247250 CCCAGCTGGAGTAAGAGCCCAGG - Exonic
1117522681 14:56566407-56566429 TCCCGCTGGTCTGTGAGCTCTGG + Intronic
1119042901 14:71291069-71291091 ACCTGCTGGACTGCAATCCCAGG - Intergenic
1121431638 14:93892163-93892185 TCCTGCTGGGCTGTTAGCCCCGG + Intergenic
1122348118 14:101072828-101072850 CCCAGCTGGATGGCGAGGCCGGG + Intergenic
1122910861 14:104826976-104826998 TCCAGCTTCCCTGGGAGCCCGGG - Intergenic
1124621165 15:31274890-31274912 TCCAGCTGTTCTGGGAGCTCAGG - Intergenic
1128460684 15:67864258-67864280 TCCCGCAGGACGGCGACCCCTGG + Intergenic
1128642853 15:69352574-69352596 TCCATCTGGACGGCAGGCCCCGG - Intronic
1128673694 15:69593862-69593884 TCCCTCTGGACTGTGAGCTCTGG + Intergenic
1128760002 15:70210145-70210167 TCCTGCTGCACTGAAAGCCCTGG - Intergenic
1131265140 15:90911217-90911239 TCCAGCTGGATTCCTCGCCCAGG + Exonic
1132902198 16:2263258-2263280 TCCAGCTCGACTTCCAGCTCAGG - Exonic
1134246891 16:12546883-12546905 TCCAGCTGCACTCCTAGCCCTGG - Intronic
1137445111 16:48526886-48526908 TGCTGCTGGGCTGCAAGCCCTGG - Intergenic
1137749271 16:50846872-50846894 TACAGCTGGAATTTGAGCCCAGG - Intergenic
1139467785 16:67163443-67163465 TCCAGCTCCACTGCCAGCCCAGG - Exonic
1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG + Intronic
1140756265 16:78070135-78070157 TCCAGGTGGACTGGGACCCAAGG + Intergenic
1141092160 16:81137706-81137728 CCCATCTGGTCTGCGAGCCAAGG - Intergenic
1141166407 16:81663931-81663953 GCCTGCTGGCCTGCGTGCCCAGG + Intronic
1141762974 16:86040703-86040725 TCCAGCTGGACTGTGAATCGGGG + Intergenic
1142210005 16:88804312-88804334 TCCAGCTTCTCTGCGAGGCCAGG + Intronic
1143446003 17:7009951-7009973 TCCAGCTGGACTGGTATGCCTGG + Exonic
1144879617 17:18424612-18424634 CCCAGGTGGGCTGCGAGGCCAGG - Intergenic
1145810290 17:27760226-27760248 TCCAGTTGGGCTTGGAGCCCTGG - Intronic
1147052204 17:37803684-37803706 TCCACGAGGACTGCGGGCCCAGG - Intergenic
1151715712 17:75830111-75830133 TCCAGCTGACCTTGGAGCCCAGG - Exonic
1151764214 17:76123877-76123899 CCCTGCTGGACTGGGAGCTCCGG - Intergenic
1152001134 17:77645947-77645969 TACAGCAGGGCTCCGAGCCCTGG + Intergenic
1152258832 17:79255694-79255716 ATCAGCTGGACTGGGAGGCCAGG - Intronic
1155201622 18:23522813-23522835 TCCTGCTGGGCTGTGAGCCCTGG + Intronic
1155503948 18:26514814-26514836 TGCAGCTGAACTGCCAGACCTGG + Intronic
1160012360 18:75115790-75115812 CCCAGCTAGACTGAGAGCCCTGG + Intergenic
1160709504 19:544575-544597 TCCAGCTGGACTGAGTGACAGGG + Intronic
1162537045 19:11268907-11268929 CACAGCTGGACTGCGTGACCTGG + Intergenic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166300603 19:41910143-41910165 TCCAGCAGGACCCAGAGCCCTGG - Intronic
1166686623 19:44800404-44800426 TCCAGCTGCGCTGGGACCCCAGG + Exonic
926103167 2:10133563-10133585 TGCAGTTGGACTGCGTGGCCTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931462617 2:62461845-62461867 CCGAGCTGGGCTGAGAGCCCAGG + Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
933835139 2:86239961-86239983 TCCAGTTGGGCAGCGAGGCCAGG - Intronic
935500282 2:103830822-103830844 TCCCTCTGGCCTACGAGCCCAGG + Intergenic
936069121 2:109353588-109353610 CCCAGCAGGCCTGCCAGCCCTGG - Intronic
936169084 2:110152482-110152504 TCCTTCTGGACTCAGAGCCCAGG - Intronic
936239418 2:110773973-110773995 TCCAGCTGCACTGGAATCCCAGG - Intronic
937354227 2:121187956-121187978 TCCAGCTGCTCTGGGGGCCCAGG + Intergenic
940849707 2:158676489-158676511 TCCAGCTTGAGAGTGAGCCCCGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942460141 2:176162943-176162965 ACCAGCTGGCTTGAGAGCCCTGG + Intronic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
947221127 2:227793333-227793355 TCCATCATGACTGCCAGCCCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947808406 2:232983885-232983907 TCCAGCTGGGCCCCGAGTCCGGG + Intronic
948604768 2:239127856-239127878 CCCAGCTGCCCTGCGAGCCCTGG - Intronic
948915563 2:241033586-241033608 TCCAGCTGGACGGGCAGCCGAGG - Intronic
1168767314 20:390466-390488 TCCAGCTAGACTGACAGCCATGG - Intronic
1168804064 20:662557-662579 CCCAGCTGGACTGGGAGGTCAGG - Exonic
1170100329 20:12692175-12692197 GACAGCTGAACTGTGAGCCCTGG + Intergenic
1171055069 20:21898603-21898625 CCCAGCTGGACAGGGACCCCAGG - Intergenic
1173548147 20:43914798-43914820 GCGAGCGGGACTGCGAGCGCGGG - Intergenic
1175619973 20:60435224-60435246 TACAGCTGGGTTGTGAGCCCTGG + Intergenic
1175912945 20:62413366-62413388 CCCAGCTGGACTCTGACCCCAGG + Intronic
1176089548 20:63312833-63312855 GCCAGCTGGACTGCATCCCCTGG - Exonic
1176298943 21:5089345-5089367 GCCTGCTGGACTGCGTTCCCGGG + Intergenic
1177109840 21:17012535-17012557 TCCAGCTCGTCTGCCAGTCCTGG + Intergenic
1179627303 21:42655903-42655925 CCTAGCTGGACTGTGAGTCCTGG + Intronic
1179858083 21:44172604-44172626 GCCTGCTGGACTGCGTTCCCGGG - Intergenic
1182354788 22:29717924-29717946 CCCACCTGGACAGCAAGCCCAGG + Intergenic
1182833980 22:33326597-33326619 CCCAGCTGGACTGCCAGCTGTGG - Intronic
1185385189 22:50528679-50528701 TCCAGCTGCACTCCTAGCCAGGG - Intronic
949125164 3:438441-438463 TCCAGCCTGATTGCAAGCCCAGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950464304 3:13144259-13144281 TGCAGCTGGACTGCACGCCCGGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953234136 3:41091447-41091469 TCCATCAGAACTGCGAGCCATGG - Intergenic
953982933 3:47421760-47421782 CTCAGCTGGCCTGCCAGCCCTGG + Intronic
955036403 3:55272449-55272471 TCCAACTGGTCTGCTAGTCCAGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
966076051 3:175937471-175937493 GCCAGCTGCCCTGCCAGCCCCGG + Intergenic
968008158 3:195256807-195256829 TCCAGCTGAAGTGAGCGCCCAGG + Intronic
968503332 4:961094-961116 TGCAGGTGGACGGGGAGCCCTGG - Exonic
968511625 4:998175-998197 TCCTGCTGGACACCCAGCCCGGG + Intronic
968702519 4:2063643-2063665 TCCAGCTGGACACCAAGCCAGGG - Intronic
970001782 4:11372209-11372231 TCCAGCTCGACTTCCAGCTCAGG + Intergenic
970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG + Intergenic
974436464 4:61863033-61863055 CTCAGCTGGACTGCCAACCCTGG - Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984186114 4:176545851-176545873 GACAACTGGACTGCGATCCCAGG - Intergenic
984778414 4:183504304-183504326 GCCTGCGGGACTGCGCGCCCCGG - Intergenic
986347667 5:6849955-6849977 CCCAGCAGGACTGCAAACCCTGG - Intergenic
986671939 5:10150402-10150424 TCCATCTGGACACCAAGCCCGGG - Intergenic
986744378 5:10731077-10731099 TCTTTCTGGACTGAGAGCCCTGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
992796118 5:80256183-80256205 GCCAGCGGAAGTGCGAGCCCGGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997471674 5:134120723-134120745 TCCAGCTGCCTTGCCAGCCCTGG + Intronic
998367308 5:141639736-141639758 TCCTCCTGGACTGGGAGCTCCGG + Exonic
999562866 5:152824249-152824271 TCAAGCTGGAATTAGAGCCCAGG - Intergenic
1000765354 5:165282697-165282719 TCCAGCTGAAATTCAAGCCCAGG - Intergenic
1002419042 5:179136008-179136030 GCCACCTGTACTGCGAGTCCAGG - Exonic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1005912817 6:30326252-30326274 TCCCGCTGGAGTGGGAGCCGGGG - Intergenic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1009929980 6:70165632-70165654 TCCAGCTGCACTGGAAGTCCAGG + Intronic
1012729893 6:102868169-102868191 TCAAGCAGTACTGCCAGCCCAGG + Intergenic
1013161085 6:107545732-107545754 TCCAGCTGAACTGCAGTCCCTGG - Intronic
1013471656 6:110471948-110471970 TCCAGCTGGACTGCAGCCCTGGG + Intronic
1014078760 6:117265613-117265635 GCCAGCTGGATTCCGAGCCGCGG + Exonic
1015620849 6:135130149-135130171 GCCAGCTGAACTGCAAACCCAGG + Intergenic
1017722525 6:157253832-157253854 TTCAGCTGGACAGCGTTCCCTGG + Intergenic
1017978619 6:159378937-159378959 TCCAGCTGGTCTGGGACCCCTGG - Intergenic
1018648090 6:165966490-165966512 ACGAGCTGGGCTGCGAGGCCTGG - Intronic
1020347800 7:7183260-7183282 TCCCGCCGGACTGGGCGCCCAGG + Intronic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1023680094 7:42676751-42676773 TTCTGCTGGACTGGAAGCCCTGG + Intergenic
1024677031 7:51646207-51646229 TGCAGCTGTAATGGGAGCCCAGG + Intergenic
1025956872 7:66189854-66189876 TCCACCTTGACTGCCAGCCTAGG + Intergenic
1026034311 7:66820093-66820115 TACCGCTGGGCTGCAAGCCCAGG + Intergenic
1026985287 7:74551427-74551449 TACTGCTGGGCTGCAAGCCCGGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035203166 7:157279443-157279465 ACCTCCTGGACTCCGAGCCCTGG - Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1037814836 8:22106696-22106718 TCCAGTTGGCCTGCTGGCCCGGG - Intergenic
1038788841 8:30648718-30648740 TCCAGCTGCTCTGCCAGCCTGGG + Intronic
1044927821 8:97224216-97224238 TCTAGCAGGACTGCATGCCCAGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047406593 8:124590498-124590520 TCGAGCTGCACTGCCAGCCTCGG + Intronic
1048451922 8:134541016-134541038 CCCAGCAGGACTCCGGGCCCTGG + Intronic
1049003066 8:139838337-139838359 CCCTGCTGGACTGCAAGCTCTGG + Intronic
1049049738 8:140185251-140185273 TCCTGCTGGACTCAGAGCCCCGG - Intronic
1049400664 8:142425573-142425595 TTCAGCTGGCCTGTGAGCCTGGG + Intergenic
1049420790 8:142515653-142515675 TCCAGCTGGTTTCCTAGCCCTGG + Intronic
1057262466 9:93592821-93592843 GCCAGGTGGACTGTGAGCCAAGG - Intronic
1059441303 9:114308567-114308589 CCCTGCTGGACTGTGAGCTCTGG - Intronic
1060429964 9:123542582-123542604 ACCAGCTGATCTGGGAGCCCAGG - Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1061398944 9:130358004-130358026 CCCAGCTGGCTTGCCAGCCCTGG - Intronic
1061484161 9:130911931-130911953 CCCAGGTGGGCTGCGAGTCCTGG - Intronic
1062344824 9:136109831-136109853 CCCAGCTGGGCAGCGTGCCCGGG - Intergenic
1062499177 9:136845017-136845039 GCCCGCAGGACCGCGAGCCCCGG - Exonic
1189134186 X:38532183-38532205 TCCAGCTGGACTTGGAGTTCAGG + Intronic
1191019325 X:55842684-55842706 TCCTGCTGGCCTGAGAACCCTGG + Intergenic
1192152874 X:68722930-68722952 TTCAGCTGGACTGCGGGGCAGGG - Intronic
1192233678 X:69283090-69283112 GCCAGCTGGACTATGATCCCTGG - Intergenic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1196442032 X:115727133-115727155 TCCAGCTAGAGAGCGAGCCAGGG - Intergenic
1196442693 X:115730095-115730117 TCCAGCTAGAGAGCGAGCCAGGG - Intergenic
1196443530 X:115733778-115733800 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196445856 X:115845705-115845727 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196446527 X:115848686-115848708 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196447196 X:115851667-115851689 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196447866 X:115854642-115854664 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196448535 X:115857629-115857651 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196449206 X:115860620-115860642 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196449876 X:115863607-115863629 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196450545 X:115866582-115866604 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196451216 X:115869571-115869593 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196451887 X:115872554-115872576 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196452557 X:115875533-115875555 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196453227 X:115878502-115878524 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196453897 X:115881511-115881533 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196454563 X:115884516-115884538 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1196454976 X:115886606-115886628 TCCAGCTAGAGAGCGAGCCAGGG + Intergenic
1200065422 X:153502261-153502283 TCCAGGTGGACTGCCCACCCTGG + Intronic