ID: 1165461124

View in Genome Browser
Species Human (GRCh38)
Location 19:35944968-35944990
Sequence CCAGCTGGACTGCGAGCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 195}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461115_1165461124 6 Left 1165461115 19:35944939-35944961 CCCGCGGCGCTCAGGGCCCACAC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461107_1165461124 21 Left 1165461107 19:35944924-35944946 CCGCCCGCCCCGGAGCCCGCGGC 0: 1
1: 1
2: 6
3: 73
4: 563
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461114_1165461124 12 Left 1165461114 19:35944933-35944955 CCGGAGCCCGCGGCGCTCAGGGC 0: 1
1: 0
2: 0
3: 18
4: 221
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461103_1165461124 26 Left 1165461103 19:35944919-35944941 CCGCCCCGCCCGCCCCGGAGCCC 0: 1
1: 1
2: 15
3: 183
4: 1599
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461104_1165461124 23 Left 1165461104 19:35944922-35944944 CCCCGCCCGCCCCGGAGCCCGCG 0: 1
1: 0
2: 8
3: 97
4: 706
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461102_1165461124 27 Left 1165461102 19:35944918-35944940 CCCGCCCCGCCCGCCCCGGAGCC 0: 1
1: 1
2: 19
3: 164
4: 1250
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461116_1165461124 5 Left 1165461116 19:35944940-35944962 CCGCGGCGCTCAGGGCCCACACC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461112_1165461124 13 Left 1165461112 19:35944932-35944954 CCCGGAGCCCGCGGCGCTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461109_1165461124 17 Left 1165461109 19:35944928-35944950 CCGCCCCGGAGCCCGCGGCGCTC 0: 1
1: 0
2: 2
3: 26
4: 266
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461105_1165461124 22 Left 1165461105 19:35944923-35944945 CCCGCCCGCCCCGGAGCCCGCGG 0: 2
1: 0
2: 7
3: 78
4: 536
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461110_1165461124 14 Left 1165461110 19:35944931-35944953 CCCCGGAGCCCGCGGCGCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461108_1165461124 18 Left 1165461108 19:35944927-35944949 CCCGCCCCGGAGCCCGCGGCGCT 0: 1
1: 0
2: 6
3: 29
4: 336
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195
1165461119_1165461124 -10 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461124 Original CRISPR CCAGCTGGACTGCGAGCCCT GGG Exonic
902366411 1:15977375-15977397 CCGGCTGGACTGAAACCCCTAGG + Intergenic
902671851 1:17980083-17980105 CCAGCTGGCCTGAGCACCCTGGG + Intergenic
902683093 1:18057686-18057708 ACAGCTGAACTGCGAGGTCTAGG - Intergenic
903568538 1:24286798-24286820 CTAGCAGGAATGCCAGCCCTAGG - Intergenic
905580447 1:39080260-39080282 CCTGCTGAACTGTGAGCCCATGG + Intergenic
905627659 1:39499095-39499117 TCCTCTGGACAGCGAGCCCTTGG - Intronic
905668765 1:39778013-39778035 TCCTCTGGACAGCGAGCCCTTGG + Intronic
906637539 1:47419210-47419232 TCAACTAGACTGGGAGCCCTGGG - Intergenic
907298858 1:53472703-53472725 CCAGCTGGGCAGCAAGTCCTGGG - Intergenic
907474218 1:54694861-54694883 GCAGCTGGAATGTGAGCCCTCGG + Intronic
909151923 1:72017575-72017597 CCAGTTGGACTGATAGCTCTGGG - Intronic
911001448 1:93170365-93170387 CCGGCCGGCCTGCAAGCCCTGGG + Intronic
911367702 1:96959149-96959171 CCTGCTGGACTGTGAGCCCCTGG - Intergenic
916039587 1:160950784-160950806 TCAGCTGGGCTGAGAGCTCTGGG + Intronic
916606051 1:166343295-166343317 CCGGCTGGCCTGCAAGCCCCGGG - Intergenic
920197820 1:204241323-204241345 TGAGCTGGGCTGCGAGCCCAGGG - Intronic
920275851 1:204803676-204803698 TGAGCTGGACTGGGAGCCCCAGG + Intergenic
924792836 1:247269198-247269220 CAAGCTGGATGGAGAGCCCTTGG - Intergenic
1063241195 10:4170911-4170933 TCAGCTGCACTGCCTGCCCTAGG - Intergenic
1064496071 10:15911863-15911885 GAAGCTGGACTGCGTGCCCTAGG + Intergenic
1069561815 10:69436006-69436028 CCTGCTGGCCTGCCAGGCCTCGG - Intergenic
1070156413 10:73838317-73838339 ACACCTGGACTGCCTGCCCTGGG + Intronic
1070968456 10:80544191-80544213 CCAGCAAGACCGCGAGCCCACGG + Intronic
1071055690 10:81505924-81505946 CCAGCCGGCCCGCAAGCCCTGGG + Intergenic
1072892918 10:99340993-99341015 CCTACTCGACTGCAAGCCCTAGG - Intronic
1073461245 10:103667154-103667176 CCAGCCAGACTGCGAGTCCAGGG - Intronic
1074879766 10:117646882-117646904 CCACCTGGCCTGGGAGCCCGGGG + Intergenic
1076289243 10:129331661-129331683 CCTTCTAGACTGCGATCCCTCGG - Intergenic
1076776852 10:132702790-132702812 CCAGCAGGACTGAGACCCATGGG + Intronic
1084632140 11:70359985-70360007 CCACCTGGAGTGCCAGCCCAGGG + Intronic
1090029858 11:123196721-123196743 CCAGCTGATCCGCGAGCCCTAGG - Intergenic
1090616141 11:128517102-128517124 ACATCTGGACTGCCAGGCCTGGG + Intronic
1090863241 11:130673004-130673026 CCAGCTTGGCTGCCACCCCTCGG + Exonic
1092834923 12:12478280-12478302 TCAGCTGCATTGGGAGCCCTGGG - Intronic
1093138718 12:15481595-15481617 CCAGCTGCACTTCCAGCTCTAGG - Intronic
1095349115 12:41188611-41188633 CCCGCTGCAGTGCCAGCCCTTGG + Exonic
1095444991 12:42274033-42274055 CCAGCTGGCCCGCAAGCACTGGG + Intronic
1096500832 12:52063089-52063111 CCAGCTGGACTTGGAGCCGGCGG + Intergenic
1098082527 12:66804238-66804260 CCAGCTGCTCTGCGAGCCGGTGG + Intergenic
1099933379 12:89098920-89098942 CCAGCTGCACTGCGAAGCCCAGG - Intergenic
1102945173 12:116980299-116980321 CCAGCTGTACTTCCTGCCCTTGG + Intronic
1103165677 12:118768405-118768427 CCAGCTGGACTCACAGCCCAAGG - Intergenic
1106675430 13:31953115-31953137 CCTGCTGGACTTCAAGCCTTGGG + Intergenic
1108493584 13:51004021-51004043 CCTGCCGGAATGAGAGCCCTTGG + Intergenic
1108857962 13:54819505-54819527 CCAGAAGGACTGCAATCCCTGGG + Intergenic
1109593639 13:64521491-64521513 CCAGCTGGTCTTCAAGTCCTGGG - Intergenic
1113647730 13:112011017-112011039 CCAGCTGCACTGCAGTCCCTGGG + Intergenic
1116849423 14:49893343-49893365 CCCGCCGGCCTGCGAGCACTGGG - Exonic
1117522683 14:56566408-56566430 CCCGCTGGTCTGTGAGCTCTGGG + Intronic
1119479661 14:74951609-74951631 CCAGCTGGGCTGCGGGGCCATGG + Intronic
1120901590 14:89580398-89580420 CCAGCTTGACTGACAGCCCTTGG - Intronic
1122436841 14:101706387-101706409 CCAGCTTGACAGGCAGCCCTGGG + Intergenic
1122585066 14:102800212-102800234 CCTGCTGGACTGGGAGCCTCTGG + Intronic
1122896132 14:104758057-104758079 CCAGCTGGGCTGCCTGGCCTGGG - Intronic
1124014823 15:25865391-25865413 CCAGCTGGACTCTGAGACCCTGG + Intergenic
1124244606 15:28058467-28058489 CCAGGTGGCCAGCGTGCCCTGGG - Intronic
1125541062 15:40470598-40470620 CCAGCTGGAAGCGGAGCCCTCGG - Intergenic
1126111853 15:45179832-45179854 CCAGCTGGGCTGGGAGGCCGTGG + Intronic
1128533544 15:68471808-68471830 CCTGCTGGACTGGTAGCCCTTGG - Intergenic
1128570432 15:68729702-68729724 CCAGCAGGACCTGGAGCCCTTGG + Intergenic
1128673696 15:69593863-69593885 CCCTCTGGACTGTGAGCTCTGGG + Intergenic
1128760000 15:70210144-70210166 CCTGCTGCACTGAAAGCCCTGGG - Intergenic
1128776701 15:70325939-70325961 CCAGCTGGGCTGCACGACCTTGG + Intergenic
1129753859 15:78084218-78084240 CAAGATGGTCTGAGAGCCCTGGG - Intronic
1129939361 15:79480269-79480291 CCAACTGGCCTGCCAGCCTTTGG - Intergenic
1132178829 15:99736070-99736092 CCAGCTGTACTTCGGGCCCAAGG + Intergenic
1132750476 16:1455298-1455320 CCTGCTGGTCCGTGAGCCCTGGG - Intronic
1134174191 16:11992686-11992708 CCTGCTTGACTGTGTGCCCTTGG + Intronic
1134509671 16:14835602-14835624 CCATCTGGACAGGCAGCCCTTGG - Intronic
1134697376 16:16234418-16234440 CCATCTGGACAGGCAGCCCTTGG - Intronic
1134974471 16:18560258-18560280 CCATCTGGACAGGCAGCCCTTGG + Intronic
1136403709 16:30031417-30031439 CCAGCTGGCCAAGGAGCCCTGGG - Intronic
1138351615 16:56348948-56348970 CCAGCTGGACTCTGAGCTCTCGG + Intronic
1138363260 16:56451164-56451186 CCAGCCGGTCTGCGAGCGATTGG + Exonic
1139467783 16:67163442-67163464 CCAGCTCCACTGCCAGCCCAGGG - Exonic
1141166409 16:81663932-81663954 CCTGCTGGCCTGCGTGCCCAGGG + Intronic
1141702290 16:85648080-85648102 CCAGCTGGCCTGTGTGTCCTGGG + Intronic
1142164835 16:88580699-88580721 TCTGATGGACTGGGAGCCCTGGG + Intronic
1142430050 16:90021276-90021298 CCAGCTGGACAGGAAGACCTAGG + Intronic
1142558504 17:795681-795703 CCAGCTGTACTGCAGGGCCTGGG + Intergenic
1142750629 17:1985377-1985399 CCAGGCGGCTTGCGAGCCCTGGG - Intronic
1143446005 17:7009952-7009974 CCAGCTGGACTGGTATGCCTGGG + Exonic
1144670002 17:17127506-17127528 CCTGCTAGACTGGGAGCTCTGGG - Intronic
1144728614 17:17514268-17514290 CCAGCTTGACTGGGAGCTCTTGG + Intronic
1144879615 17:18424611-18424633 CCAGGTGGGCTGCGAGGCCAGGG - Intergenic
1145810235 17:27759969-27759991 CAAGCTCCACTGTGAGCCCTGGG - Intronic
1145941720 17:28746238-28746260 CCAGCAGGACTCAGGGCCCTGGG - Intronic
1147646989 17:42039968-42039990 CCAGCTGGCGTGCGCGCACTCGG - Intronic
1148219640 17:45852355-45852377 ACAGCTGGACTTTGAGACCTGGG + Intergenic
1148559442 17:48597511-48597533 CCAGCCGCACTGGGAGCCATGGG - Intronic
1148818183 17:50345823-50345845 CCACCTGGACGGCGAGCGCCTGG - Intergenic
1150239995 17:63623077-63623099 CGAGCCGGACCGCGAGCCCGAGG + Intronic
1151764212 17:76123876-76123898 CCTGCTGGACTGGGAGCTCCGGG - Intergenic
1152001135 17:77645948-77645970 ACAGCAGGGCTCCGAGCCCTGGG + Intergenic
1152225621 17:79091296-79091318 CCAGCTGGCCTTCCAGCCCCAGG + Intronic
1152962474 18:88080-88102 CCTGCTGGAGTGTGAGGCCTGGG + Intergenic
1157522075 18:48352330-48352352 CCAGCAGGGCTGTGAGCACTTGG - Intronic
1157874135 18:51255880-51255902 CCAGCTGGACTACAAGCTCCTGG + Intergenic
1162386705 19:10364548-10364570 CCAACTAGACTGTGAGCCCTAGG - Intronic
1162419860 19:10559911-10559933 CCAGCTGGACTGGGGGACCGTGG + Exonic
1162835958 19:13318158-13318180 ACAGAGGGACTGGGAGCCCTTGG + Intronic
1163443634 19:17334206-17334228 CCAGCTTGACTGTGTGACCTTGG - Intronic
1165461124 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG + Exonic
1166831934 19:45644523-45644545 CCAGCTGCACTGTCAGGCCTTGG + Intronic
1167269516 19:48499316-48499338 CCAGCTGGTGTCCGAGACCTGGG - Exonic
1167379940 19:49132959-49132981 CCCCGTGGACTGCGAGCCCCTGG - Intronic
1167793553 19:51694785-51694807 CCATCTGGACTTCCAGCTCTAGG - Intergenic
926018264 2:9473651-9473673 CCGGCTGGAATGAGGGCCCTAGG + Intronic
927342456 2:21997777-21997799 CCATCTGTACTCCCAGCCCTGGG - Intergenic
927436619 2:23072028-23072050 CCAGCAGGACTCTGAGCCCTTGG + Intergenic
928393809 2:30929163-30929185 CAACCTGGACTGCCAGCTCTAGG - Intronic
929594911 2:43169887-43169909 CCAGCTAGACTGAGAACCCCAGG + Intergenic
929961913 2:46503390-46503412 CCAGCAGGACTGCTAAACCTAGG - Intronic
932866670 2:75350557-75350579 CCAACTGGCCTGCTAGGCCTGGG - Intergenic
933506317 2:83181141-83181163 CCAGCCGGCCTGCAAGCCCCGGG + Intergenic
933899091 2:86836365-86836387 TAAGCAAGACTGCGAGCCCTGGG + Intronic
934490673 2:94760429-94760451 CCCGCTGGGCTCCAAGCCCTGGG - Intergenic
935781461 2:106512861-106512883 TAAGCAAGACTGCGAGCCCTGGG - Intergenic
937756523 2:125545838-125545860 CCAGCTGGGCTGGAGGCCCTGGG - Intergenic
938447406 2:131389575-131389597 TCATCTTGCCTGCGAGCCCTGGG + Intergenic
941111640 2:161423651-161423673 CCGGCTGGACTTCGCGGCCTCGG + Exonic
943965055 2:194321779-194321801 CCAGCAGGACTAAGAACCCTTGG + Intergenic
946392576 2:219425587-219425609 CCAGATGGACTCCCAGCCCCTGG + Intronic
946394482 2:219436250-219436272 CCAGCTGGACCATGAGCACTGGG - Intronic
946411042 2:219515317-219515339 CCAGCTGGGCTGCCTGGCCTTGG + Intronic
948402489 2:237693739-237693761 CCTGCTGGACTTAGAGTCCTTGG + Intronic
1168767312 20:390465-390487 CCAGCTAGACTGACAGCCATGGG - Intronic
1168831660 20:848412-848434 CCAGTTGGAGTGTGAGCCCTCGG + Intronic
1169135081 20:3192352-3192374 CCAGCCGGACTGCGAGCTCCAGG - Intronic
1170100330 20:12692176-12692198 ACAGCTGAACTGTGAGCCCTGGG + Intergenic
1173085822 20:39915965-39915987 CCAGCTGGACTGAAAACACTAGG + Intergenic
1173548146 20:43914797-43914819 CGAGCGGGACTGCGAGCGCGGGG - Intergenic
1173564255 20:44027914-44027936 CCAGGTGGGCTGGGAGCTCTAGG - Intronic
1175422636 20:58844491-58844513 CAACCTGGGCTGCTAGCCCTGGG - Intronic
1175829500 20:61954375-61954397 CCAGCTGCAGTGGGACCCCTTGG - Intronic
1180802094 22:18636694-18636716 CCCGCCTGACTGCGAGCCCACGG - Intergenic
1180853331 22:19032246-19032268 CCCGCCTGACTGCGAGCCCACGG - Intergenic
1180935427 22:19622221-19622243 CCTGCTGGGGTGAGAGCCCTTGG + Intergenic
1180955007 22:19737649-19737671 CCAGATGGGCTGAGGGCCCTGGG - Intergenic
1181219629 22:21358565-21358587 CCCGCCTGACTGCGAGCCCACGG + Intergenic
1182833978 22:33326596-33326618 CCAGCTGGACTGCCAGCTGTGGG - Intronic
1182900018 22:33890033-33890055 CCAGCTGGGCTGGGAGGGCTTGG - Intronic
1183479302 22:38054288-38054310 CCAGCTGGACAGGAAGCCCCTGG - Intergenic
1184090682 22:42291498-42291520 CCGTCTGGACTATGAGCCCTGGG + Intronic
1185176109 22:49327940-49327962 TCAGCTGGACTGCATGGCCTTGG + Intergenic
1185213862 22:49587467-49587489 CTGGCTGGGCTGAGAGCCCTGGG - Intronic
1185410428 22:50678776-50678798 CCAGCTGGGCTGCGAGGCTCAGG - Intergenic
950002424 3:9667545-9667567 CCAGCAGGAATGCCAGCCCTTGG + Intronic
950106692 3:10393102-10393124 CCAGCTAGACTGTGAGCTCCTGG - Intronic
950413333 3:12853436-12853458 CAAGTAGGACAGCGAGCCCTAGG + Intronic
953234134 3:41091446-41091468 CCATCAGAACTGCGAGCCATGGG - Intergenic
953857137 3:46508028-46508050 CCACCTGGTCTGTGAGCCTTTGG - Intergenic
953982934 3:47421761-47421783 TCAGCTGGCCTGCCAGCCCTGGG + Intronic
960141861 3:114158943-114158965 CCAGCCTCACTGAGAGCCCTGGG - Intronic
961354752 3:126330122-126330144 CCAGCTGGCCTGCTGGCCCAAGG + Intergenic
964375045 3:156041417-156041439 CCAGCCGGCCTGCAAGCCCCGGG + Intronic
965476904 3:169167326-169167348 CCAGTTGGACTGCAAGCCATTGG + Intronic
966076053 3:175937472-175937494 CCAGCTGCCCTGCCAGCCCCGGG + Intergenic
968503331 4:961093-961115 GCAGGTGGACGGGGAGCCCTGGG - Exonic
968554355 4:1239696-1239718 CCAGCCGTACTGGGAGCCCTCGG - Intronic
969528032 4:7713983-7714005 CCAGCAGCTCTGCGACCCCTCGG + Intronic
970458832 4:16252621-16252643 CCAGGTGAACTGTGAGCCCTTGG + Intergenic
972437765 4:39050363-39050385 CCAGCTGTACTTCTTGCCCTTGG - Intronic
982584711 4:157222197-157222219 ACAGCCCGACTGCGCGCCCTGGG - Intronic
983972513 4:173892411-173892433 CCCACTGGACTGCAAGCCCCTGG - Intergenic
985628275 5:1001463-1001485 CCAGCTGGCCTGCTGTCCCTGGG + Intergenic
988949136 5:36240966-36240988 TCTGCAGGACTGCGAGGCCTAGG - Intronic
989205322 5:38804193-38804215 CCTGCGGGACAGCAAGCCCTTGG - Intergenic
997976716 5:138445408-138445430 CCATCTGGACTCCTTGCCCTTGG - Intronic
998137569 5:139682164-139682186 CTAGCTGGAGTGCCAGGCCTGGG + Intronic
1001409764 5:171502460-171502482 CCAGCTGAACACCGAGCCCCAGG - Intergenic
1002419040 5:179136007-179136029 CCACCTGTACTGCGAGTCCAGGG - Exonic
1002900491 6:1406392-1406414 CCAGCTGCTCTGAGAGCCCGCGG + Intergenic
1004868117 6:19874214-19874236 CCCGCTGGACTGTGAGATCTGGG + Intergenic
1006442733 6:34062137-34062159 CCAGCCTGACTCCCAGCCCTGGG + Intronic
1007385060 6:41514909-41514931 CCATCTGCCCTGCGTGCCCTTGG - Intergenic
1008034584 6:46733104-46733126 GCAGCTGGAGTGGGAGCCCCTGG - Intronic
1008648965 6:53544610-53544632 CCAGCTCAGCGGCGAGCCCTGGG + Exonic
1012400037 6:98835170-98835192 CCAGCCGGACATCAAGCCCTCGG + Exonic
1017032778 6:150238646-150238668 CCAGCTGGCCTGGGAGCTCCTGG + Intronic
1017722526 6:157253833-157253855 TCAGCTGGACAGCGTTCCCTGGG + Intergenic
1018455449 6:163947750-163947772 CCTGCTGGATTGTGAACCCTTGG - Intergenic
1019696783 7:2450756-2450778 CCAGCTTGGATGAGAGCCCTGGG - Intergenic
1019713462 7:2527804-2527826 CCAGCTGGACAGCCAGCCACTGG - Exonic
1022044708 7:26613678-26613700 CCCGGTGGAGTTCGAGCCCTCGG - Intergenic
1022660856 7:32365174-32365196 TCAGCTGGACTGGGAGCACAAGG - Intergenic
1023067849 7:36396752-36396774 CCAGCTGTTCTGCCACCCCTGGG - Intronic
1023396237 7:39754268-39754290 CTAGCTGGCCTGCAAGCCCCGGG + Intergenic
1023680095 7:42676752-42676774 TCTGCTGGACTGGAAGCCCTGGG + Intergenic
1029690452 7:102177850-102177872 CCTGCTGGGCTGTAAGCCCTGGG + Intronic
1034268213 7:149791298-149791320 CCAGGGGGGCTGCCAGCCCTGGG + Intergenic
1034632170 7:152539189-152539211 CCAGCTGGCCCGCAAGCGCTGGG + Intergenic
1035203164 7:157279442-157279464 CCTCCTGGACTCCGAGCCCTGGG - Intergenic
1040105589 8:43539782-43539804 CCTGCTGGGCTTCAAGCCCTGGG + Intergenic
1041336421 8:56789544-56789566 CCAGGTGGAATGTTAGCCCTTGG - Intergenic
1046288870 8:112132723-112132745 CCAGCTGGCCTGCAAGCGCCGGG - Intergenic
1047333965 8:123918934-123918956 CCTGCTGGACTGAGAGCCCTTGG - Intronic
1048451924 8:134541017-134541039 CCAGCAGGACTCCGGGCCCTGGG + Intronic
1049003068 8:139838338-139838360 CCTGCTGGACTGCAAGCTCTGGG + Intronic
1049049736 8:140185250-140185272 CCTGCTGGACTCAGAGCCCCGGG - Intronic
1049320996 8:141996319-141996341 CCAGCTGGTCTGAGTGCCCCTGG + Intergenic
1049989765 9:979496-979518 CCAGCTGGAAACTGAGCCCTTGG - Intronic
1051259800 9:15251977-15251999 CCAACTGGACTGAGAGCTCCAGG - Intronic
1052881442 9:33603093-33603115 CCTGCTGGGCTCCAAGCCCTGGG + Intergenic
1053157497 9:35791412-35791434 CCTGCTGGCCGGCGAGGCCTTGG + Intergenic
1056735929 9:89209501-89209523 CCAGCTGGCCCGCAAGCCCCAGG + Intergenic
1060429962 9:123542581-123542603 CCAGCTGATCTGGGAGCCCAGGG - Intronic
1060586076 9:124786871-124786893 CCAGCTGGCCAGCCAGCCTTGGG - Intronic
1061230950 9:129315540-129315562 CCACCTGGACCCCCAGCCCTCGG + Intergenic
1061398942 9:130358003-130358025 CCAGCTGGCTTGCCAGCCCTGGG - Intronic
1061484159 9:130911930-130911952 CCAGGTGGGCTGCGAGTCCTGGG - Intronic
1062134497 9:134917823-134917845 CTAGCAGGACAGCGAGCCCCCGG + Exonic
1062499175 9:136845016-136845038 CCCGCAGGACCGCGAGCCCCGGG - Exonic
1062543474 9:137051748-137051770 CCACCTGGTCTGGGAGCCCACGG - Intronic
1062735666 9:138136037-138136059 CCTGCTGGAGTGTGAGGCCTGGG - Intergenic
1187145906 X:16637144-16637166 CCAGCTGGTCTCCGACTCCTGGG + Intronic
1189238086 X:39504004-39504026 GCAGCTGGACTACCAGCCTTGGG + Intergenic
1192233676 X:69283089-69283111 CCAGCTGGACTATGATCCCTGGG - Intergenic
1192264368 X:69529037-69529059 CCAGCAGGAATGCCAGCGCTGGG + Exonic
1193980963 X:88181185-88181207 CCAGAAGGACTGCGATCCTTAGG - Intergenic
1194025598 X:88746589-88746611 CCGGCTGGCCTGCAAGCCCCGGG - Intergenic
1199679104 X:150213308-150213330 CCAGCTGAACTACAAGCCCCAGG - Intergenic