ID: 1165461125

View in Genome Browser
Species Human (GRCh38)
Location 19:35944969-35944991
Sequence CAGCTGGACTGCGAGCCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461112_1165461125 14 Left 1165461112 19:35944932-35944954 CCCGGAGCCCGCGGCGCTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461105_1165461125 23 Left 1165461105 19:35944923-35944945 CCCGCCCGCCCCGGAGCCCGCGG 0: 2
1: 0
2: 7
3: 78
4: 536
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461107_1165461125 22 Left 1165461107 19:35944924-35944946 CCGCCCGCCCCGGAGCCCGCGGC 0: 1
1: 1
2: 6
3: 73
4: 563
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461110_1165461125 15 Left 1165461110 19:35944931-35944953 CCCCGGAGCCCGCGGCGCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461104_1165461125 24 Left 1165461104 19:35944922-35944944 CCCCGCCCGCCCCGGAGCCCGCG 0: 1
1: 0
2: 8
3: 97
4: 706
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461108_1165461125 19 Left 1165461108 19:35944927-35944949 CCCGCCCCGGAGCCCGCGGCGCT 0: 1
1: 0
2: 6
3: 29
4: 336
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461114_1165461125 13 Left 1165461114 19:35944933-35944955 CCGGAGCCCGCGGCGCTCAGGGC 0: 1
1: 0
2: 0
3: 18
4: 221
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461103_1165461125 27 Left 1165461103 19:35944919-35944941 CCGCCCCGCCCGCCCCGGAGCCC 0: 1
1: 1
2: 15
3: 183
4: 1599
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461116_1165461125 6 Left 1165461116 19:35944940-35944962 CCGCGGCGCTCAGGGCCCACACC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461115_1165461125 7 Left 1165461115 19:35944939-35944961 CCCGCGGCGCTCAGGGCCCACAC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461109_1165461125 18 Left 1165461109 19:35944928-35944950 CCGCCCCGGAGCCCGCGGCGCTC 0: 1
1: 0
2: 2
3: 26
4: 266
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461102_1165461125 28 Left 1165461102 19:35944918-35944940 CCCGCCCCGCCCGCCCCGGAGCC 0: 1
1: 1
2: 19
3: 164
4: 1250
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461120_1165461125 -10 Left 1165461120 19:35944956-35944978 CCACACCGTGGTCCAGCTGGACT 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185
1165461119_1165461125 -9 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461125 Original CRISPR CAGCTGGACTGCGAGCCCTG GGG Exonic
900207600 1:1438275-1438297 CAGCTGCACTGGGTGACCTGGGG - Intronic
900598611 1:3493625-3493647 CACCTGGACTGTGCCCCCTGGGG - Intronic
901830009 1:11886535-11886557 CAGCGGGACTAAGAGCCCTTTGG + Intergenic
902411025 1:16211668-16211690 TAGCTGGGATGCCAGCCCTGTGG + Intronic
903068294 1:20713585-20713607 CAGGTGGACTTCGAGCTCTGAGG - Intronic
904484814 1:30817728-30817750 CAGGTGGACTTGGAGACCTGTGG - Intergenic
906199426 1:43949498-43949520 CAGCTGAAGTGCCAGGCCTGTGG - Exonic
906637538 1:47419209-47419231 CAACTAGACTGGGAGCCCTGGGG - Intergenic
906654868 1:47540766-47540788 CTTCTGCACTGCCAGCCCTGTGG + Intergenic
907298857 1:53472702-53472724 CAGCTGGGCAGCAAGTCCTGGGG - Intergenic
908888558 1:68817749-68817771 CAGCTGGCCTGCAAGCGCCGCGG - Intergenic
909367604 1:74846008-74846030 CAGCAGGAGTGCAGGCCCTGAGG - Intergenic
912454183 1:109786886-109786908 GGGCTGGCCTGGGAGCCCTGGGG + Intergenic
912692099 1:111812260-111812282 CAGCTGGGCAGCTGGCCCTGAGG - Intronic
912735174 1:112143975-112143997 CAGCTGGGCTGCGATCGCTGTGG + Intergenic
913708610 1:121455363-121455385 CAGAAGGCCTGAGAGCCCTGGGG - Intergenic
915457649 1:156051311-156051333 CAGCTGGATCTTGAGCCCTGAGG + Exonic
916031519 1:160881386-160881408 CAGCTGGACTGTGAGAGCTCTGG + Intronic
916507340 1:165439967-165439989 AGGCTGGGCTGGGAGCCCTGAGG + Intronic
917978592 1:180255737-180255759 CAGCTGAACTGCACGCTCTGGGG - Intronic
920197819 1:204241322-204241344 GAGCTGGGCTGCGAGCCCAGGGG - Intronic
1062784583 10:252181-252203 CAGATGGAAAGGGAGCCCTGGGG - Intronic
1063980643 10:11449043-11449065 CGGCTGGACTCCTAGCCTTGTGG - Intergenic
1065930272 10:30472926-30472948 CAGCTGGACTGACAGCCCCCAGG - Intergenic
1067550254 10:47229385-47229407 CACTTGGACAGAGAGCCCTGGGG + Intergenic
1067993500 10:51242583-51242605 CCCCTAGACTGCGAGCCTTGAGG - Intronic
1069861720 10:71475762-71475784 TAGCTGGAATGCAGGCCCTGAGG + Intronic
1069871696 10:71536914-71536936 CTGCTGTCCTGCGAGCCTTGAGG + Intronic
1070575310 10:77672930-77672952 CAGCTAGAATTCCAGCCCTGGGG - Intergenic
1070642856 10:78181686-78181708 CAGGAGGACTGTGAGTCCTGAGG + Intergenic
1072238553 10:93473999-93474021 CAGCTGGAGTGTGCACCCTGTGG - Intronic
1074346955 10:112695685-112695707 CAGATGCACTGCGTGCCCAGTGG + Intronic
1076726608 10:132416885-132416907 CAGCCGGGCTGTGGGCCCTGAGG + Intronic
1076732405 10:132445280-132445302 TAGCTGCAGGGCGAGCCCTGGGG + Intronic
1077508727 11:2944208-2944230 CAGCTTCACTGCGGGCCCAGGGG - Intergenic
1080594164 11:33754476-33754498 CAGCTGGATTTCGAGCCATTTGG + Exonic
1083544198 11:63537041-63537063 CAGCTGGACAGGGAGTCCTCTGG + Intronic
1083989460 11:66237972-66237994 CAGCTGGGCTGGGAGTCCAGAGG - Intronic
1084066066 11:66705089-66705111 CAGCTGAACTCCAAGCCCAGTGG - Exonic
1084120863 11:67068234-67068256 CAGCTGGACTGCCTGCTCGGAGG - Intronic
1084398615 11:68931045-68931067 CAGCTGGGCTGCCAGTCCTGTGG - Intronic
1084603432 11:70159735-70159757 CAGCTGGAGCGCCAGGCCTGTGG - Intronic
1084632141 11:70359986-70360008 CACCTGGAGTGCCAGCCCAGGGG + Intronic
1085508401 11:77073116-77073138 GTGCTGGACTGGGAGCCCCGAGG + Intronic
1086043001 11:82501188-82501210 CAGCTGGCCCGCAAGCGCTGTGG - Intergenic
1086942984 11:92817154-92817176 CAGCTGGGCTGAGTGCCCTGAGG + Intronic
1089344057 11:117778809-117778831 GTGCTGGGCTGGGAGCCCTGAGG - Intronic
1089345189 11:117786564-117786586 CAGGTGGGGTGGGAGCCCTGGGG - Intronic
1090616142 11:128517103-128517125 CATCTGGACTGCCAGGCCTGGGG + Intronic
1091207657 11:133832717-133832739 CAGCTGCCCTCCCAGCCCTGTGG - Intergenic
1096240723 12:49958757-49958779 CAGCTAGACTGTAAGCCCTTTGG + Exonic
1101334112 12:103781326-103781348 CAGCTTGACTCTGAACCCTGAGG + Intronic
1103536817 12:121638994-121639016 CAGCTGGTGTGTCAGCCCTGGGG + Intronic
1106156086 13:27157901-27157923 CAACTAGACTGCAAGCCCTTTGG + Intronic
1113647731 13:112011018-112011040 CAGCTGCACTGCAGTCCCTGGGG + Intergenic
1115417501 14:33153468-33153490 CAGGTGTTCTGGGAGCCCTGTGG + Intronic
1115436557 14:33381609-33381631 CAGCTGGGATTCGAACCCTGAGG + Intronic
1122607221 14:102954865-102954887 CAGCTGGCCGGCCTGCCCTGAGG + Intronic
1124465803 15:29938921-29938943 CAGCTGGCCAGCTTGCCCTGGGG + Intronic
1124719330 15:32098107-32098129 CAGGTGAACTGGGAGACCTGGGG - Intronic
1128081903 15:64861865-64861887 CAGCTGGAAGACGAGCTCTGAGG - Intronic
1128345183 15:66848869-66848891 CGGCTGGACTGGGAGTCCTATGG - Intergenic
1129572132 15:76699613-76699635 GCGCTGGACTGCATGCCCTGGGG + Intronic
1131058173 15:89388776-89388798 CAGCAGTCCTGGGAGCCCTGGGG + Intergenic
1131285026 15:91049714-91049736 CAGCTGGACTGTGAACTCGGGGG + Intergenic
1133784488 16:8963727-8963749 CGGCGGGCCTGCGGGCCCTGGGG + Intronic
1133859023 16:9576631-9576653 CAACTGGTCTTCCAGCCCTGAGG - Intergenic
1136362862 16:29792358-29792380 ACCCTGGACTGTGAGCCCTGGGG + Intronic
1136543525 16:30942432-30942454 CAGCCCCACTGCCAGCCCTGCGG + Exonic
1136559476 16:31030588-31030610 AAGCTGGACTCCAAGCCTTGTGG - Intergenic
1137334326 16:47533327-47533349 CGGCTGGACTGCCAGTCCTGTGG - Intronic
1140846047 16:78889093-78889115 CAGCTTCACTGCCTGCCCTGTGG + Intronic
1142159673 16:88550543-88550565 CTGCCGGACTCAGAGCCCTGGGG + Intergenic
1142164836 16:88580700-88580722 CTGATGGACTGGGAGCCCTGGGG + Intronic
1142192719 16:88725303-88725325 CAGGCGGGCTGGGAGCCCTGTGG + Intronic
1142263584 16:89053607-89053629 GAGCTGGTGTCCGAGCCCTGAGG + Intergenic
1142558505 17:795682-795704 CAGCTGTACTGCAGGGCCTGGGG + Intergenic
1142750628 17:1985376-1985398 CAGGCGGCTTGCGAGCCCTGGGG - Intronic
1144728615 17:17514269-17514291 CAGCTTGACTGGGAGCTCTTGGG + Intronic
1145941719 17:28746237-28746259 CAGCAGGACTCAGGGCCCTGGGG - Intronic
1148559441 17:48597510-48597532 CAGCCGCACTGGGAGCCATGGGG - Intronic
1155987287 18:32243583-32243605 CAGCTGCACTGCCAGATCTGTGG - Intronic
1156964400 18:43073104-43073126 AAGCTGGACTGTGGCCCCTGAGG - Intronic
1157523714 18:48362920-48362942 CAGCTGGACAGTGGGCCCTCAGG - Intronic
1158478898 18:57803423-57803445 GGGCTGGACTGCAAGCCCCGGGG + Intergenic
1158547088 18:58405681-58405703 CAGCTGGTCGGTCAGCCCTGAGG + Intergenic
1161801206 19:6417609-6417631 CGGCTGGACTAAGAGCCGTGAGG + Intronic
1162386704 19:10364547-10364569 CAACTAGACTGTGAGCCCTAGGG - Intronic
1163153586 19:15428463-15428485 GAGCTGGACTGCCAGCTGTGCGG - Intronic
1165461125 19:35944969-35944991 CAGCTGGACTGCGAGCCCTGGGG + Exonic
1167261296 19:48460108-48460130 CAGCTGACCTCAGAGCCCTGAGG + Intronic
1167530026 19:50009441-50009463 CCATTGGACTGGGAGCCCTGAGG + Intronic
1168158603 19:54492986-54493008 AACCTGGACTGCGAAGCCTGAGG - Intergenic
926315041 2:11703391-11703413 CAACTGCTCTGAGAGCCCTGGGG + Intronic
926425097 2:12732789-12732811 CAGCTGGACTGGCTGCCCAGAGG + Intronic
927709114 2:25314236-25314258 CACCTGGCCTGTGAGGCCTGGGG + Intronic
927952749 2:27184270-27184292 CAGCTGGACTGGAAACCATGTGG - Intergenic
928178541 2:29051649-29051671 CTGCTGGGCTGCCAGCCCTTTGG + Intronic
930149848 2:48047663-48047685 CATCTTGACTGCCTGCCCTGAGG + Intergenic
933778704 2:85787149-85787171 CAGCTGGACAGTGGGCCTTGGGG - Exonic
933899092 2:86836366-86836388 AAGCAAGACTGCGAGCCCTGGGG + Intronic
934574849 2:95393412-95393434 CAGCTGGACTGCTAGGATTGTGG + Intergenic
935194451 2:100804144-100804166 CAGCTGCACTGGTAGCCCTCTGG - Intergenic
935781460 2:106512860-106512882 AAGCAAGACTGCGAGCCCTGGGG - Intergenic
936030669 2:109067915-109067937 CAGCTGGAGCTGGAGCCCTGTGG - Intergenic
937097091 2:119242452-119242474 ATGCTGGCCTGCGAGCCCTGAGG + Intronic
937291514 2:120784903-120784925 CACCTGGACTGGAAGCTCTGGGG + Intronic
948391256 2:237613096-237613118 CACCTGGTCTCCCAGCCCTGCGG + Intergenic
948444302 2:238020169-238020191 CCACTGGGCTGTGAGCCCTGAGG + Intronic
948670602 2:239566287-239566309 CACCTGTCCTGCCAGCCCTGTGG - Intergenic
948947912 2:241230626-241230648 CAGTTCCACTGCCAGCCCTGGGG + Intronic
1169135080 20:3192351-3192373 CAGCCGGACTGCGAGCTCCAGGG - Intronic
1172702634 20:36862707-36862729 ATGCTGGACTGCGGGCCCAGCGG - Exonic
1173548145 20:43914796-43914818 GAGCGGGACTGCGAGCGCGGGGG - Intergenic
1173854423 20:46240943-46240965 CAGGTGGGCTGTGGGCCCTGGGG - Exonic
1175714162 20:61244525-61244547 CCGCTGGACTGTGAGGTCTGAGG + Intergenic
1175773198 20:61636615-61636637 CAGCTGGGCTGAAAGCCCCGTGG - Intronic
1178392139 21:32207484-32207506 CAGCTGGACTGCAGTACCTGAGG - Intergenic
1179185310 21:39081311-39081333 CAGCAGGACATGGAGCCCTGGGG - Intergenic
1180038538 21:45263783-45263805 CTGCTGGCCTGCGAGTGCTGTGG - Intergenic
1180225007 21:46387006-46387028 CAGCAGGACTCAGAGGCCTGGGG - Intronic
1180855124 22:19040754-19040776 GAGCTGGGCTGAGGGCCCTGAGG + Intronic
1180955006 22:19737648-19737670 CAGATGGGCTGAGGGCCCTGGGG - Intergenic
1181012848 22:20052557-20052579 CAGCTGGACTGGCAGGCCCGAGG + Exonic
1181767485 22:25102248-25102270 CAGATGGACTGTGAGGCCTTAGG + Intronic
1182498416 22:30727513-30727535 AGGCTGGACAGCGAGCTCTGTGG + Intronic
1182508615 22:30803057-30803079 CAGATGGACTGAGAGCGCGGCGG + Intronic
1183020161 22:35020454-35020476 CAACGGGACTGCGAGCCTGGAGG + Intergenic
1184090683 22:42291499-42291521 CGTCTGGACTATGAGCCCTGGGG + Intronic
1185289725 22:50017325-50017347 CCGCTGGGATGAGAGCCCTGGGG - Intronic
1185380512 22:50505595-50505617 CAGCTAGAGTGGGAGTCCTGTGG + Intronic
949489751 3:4577210-4577232 CAGCTGCACAGAGAGCCGTGTGG - Intronic
953982935 3:47421762-47421784 CAGCTGGCCTGCCAGCCCTGGGG + Intronic
957615477 3:82520696-82520718 CAGCTGGACTGCAAGACCTGAGG + Intergenic
960141860 3:114158942-114158964 CAGCCTCACTGAGAGCCCTGGGG - Intronic
961862446 3:129927525-129927547 CACCTGGACAGCTTGCCCTGAGG + Intergenic
963711936 3:148756216-148756238 CTGCTGGACCGAGAGACCTGAGG + Intergenic
964375046 3:156041418-156041440 CAGCCGGCCTGCAAGCCCCGGGG + Intronic
964590729 3:158360381-158360403 CAGCTGGGCTGCCAGTCCTATGG - Intronic
965476905 3:169167327-169167349 CAGTTGGACTGCAAGCCATTGGG + Intronic
966996159 3:185282883-185282905 CAGCGGGACTGCGGGTCCGGTGG + Intergenic
967880617 3:194298795-194298817 GAGCTGGAGTGCGAGCTCTTTGG - Intergenic
968915042 4:3493634-3493656 GAGCTGGAGGGCGCGCCCTGTGG + Exonic
971774932 4:30950891-30950913 CTGCTGGAGTTTGAGCCCTGAGG - Intronic
972341291 4:38154844-38154866 CAGCTGGGGTGGGGGCCCTGGGG - Intergenic
972737703 4:41861238-41861260 CAGCTGTAATGAGAACCCTGTGG - Intergenic
973048163 4:45562181-45562203 GAGCTGTACTCTGAGCCCTGAGG - Intergenic
976512812 4:85930529-85930551 CAGCTGGACTGAGATTCCTCTGG - Intronic
982209590 4:153023578-153023600 CTGCAGGAGTGCCAGCCCTGAGG - Intergenic
982584710 4:157222196-157222218 CAGCCCGACTGCGCGCCCTGGGG - Intronic
987710904 5:21499740-21499762 CACCTGGAATGCTAGCCCTTTGG + Intergenic
988749235 5:34177881-34177903 CACCTGGAATGCTAGCCCTTTGG - Intergenic
988949135 5:36240965-36240987 CTGCAGGACTGCGAGGCCTAGGG - Intronic
989969481 5:50505185-50505207 CAGAAGGCCTGAGAGCCCTGGGG + Intergenic
991761243 5:69918800-69918822 CACCTGGAATGCTAGCCCTTTGG + Intergenic
991786086 5:70199300-70199322 CACCTGGAATGCTAGCCCTTTGG - Intergenic
991840471 5:70793851-70793873 CACCTGGAATGCTAGCCCTTTGG + Intergenic
991878530 5:71199688-71199710 CACCTGGAATGCTAGCCCTTTGG - Intergenic
992407010 5:76469085-76469107 CAGCTAGACTGCCAGCCTAGCGG + Intronic
993551622 5:89280522-89280544 CAGCTGTGCTGTGAGGCCTGAGG + Intergenic
996357729 5:122615355-122615377 CAGCTGCACTGGAAGCCCTCTGG - Intergenic
997596284 5:135109285-135109307 CAGCTGGACTCCGAGGCCTCTGG - Intronic
999373826 5:151072595-151072617 CAGCATGACAGCCAGCCCTGAGG + Intronic
1000050133 5:157555806-157555828 CAGCAGGGCTGCGTGCCCTCTGG + Intronic
1000073562 5:157763813-157763835 CAGCTGGCCTGCTGCCCCTGGGG - Intergenic
1000891850 5:166810526-166810548 CAGCTGGCCTGCAAGCACTGCGG + Intergenic
1002668743 5:180847484-180847506 CAGCTGAGCTGCTAGCCCTGTGG + Intergenic
1003393839 6:5736208-5736230 CAGCTGCAATGCTTGCCCTGTGG - Intronic
1004868119 6:19874215-19874237 CCGCTGGACTGTGAGATCTGGGG + Intergenic
1005546786 6:26880757-26880779 CACCTGGAATGCTAGCCCTTTGG - Intergenic
1008034583 6:46733103-46733125 CAGCTGGAGTGGGAGCCCCTGGG - Intronic
1008048912 6:46880196-46880218 CAGCTGGTGTCTGAGCCCTGAGG + Intronic
1008654113 6:53593858-53593880 CACCTTGACTGCATGCCCTGGGG + Intronic
1009017541 6:57921841-57921863 CACCTGGAATGCTAGCCCTTTGG - Intergenic
1016833364 6:148454226-148454248 CAGCAGGAATGTGAGCGCTGTGG + Intronic
1019481705 7:1269961-1269983 CAGCTGAGCTGTGAGCACTGTGG + Intergenic
1020144779 7:5634156-5634178 CACGTGGACAGCCAGCCCTGGGG - Intronic
1020222253 7:6248598-6248620 CAGCTGAACTGGGAGGCCAGAGG - Intronic
1022660855 7:32365173-32365195 CAGCTGGACTGGGAGCACAAGGG - Intergenic
1023680096 7:42676753-42676775 CTGCTGGACTGGAAGCCCTGGGG + Intergenic
1028382178 7:90211885-90211907 CAGCTGGAGTGCGACCGCCGCGG + Exonic
1030618012 7:111758568-111758590 CAGATAGACTGCGAGCCCCTTGG - Intronic
1032245782 7:130210697-130210719 CAGCAGGAGTGCCTGCCCTGAGG - Intronic
1034434840 7:151058483-151058505 CAGCTGTTCTCCCAGCCCTGCGG - Exonic
1037813103 8:22098182-22098204 CAGCTGGACGGGGAGTCCTGTGG + Exonic
1040514965 8:48127057-48127079 GTGCTGGACTGGGAGGCCTGAGG + Intergenic
1045475605 8:102549892-102549914 CAGCTGGACTGTAAGCCACGAGG - Intergenic
1046262421 8:111786480-111786502 GAGCTGGACTAGGAGGCCTGGGG + Intergenic
1046288869 8:112132722-112132744 CAGCTGGCCTGCAAGCGCCGGGG - Intergenic
1047407162 8:124595385-124595407 CAGAAGGAATGCCAGCCCTGTGG - Intronic
1048280606 8:133102882-133102904 CAGGTGGAGTGGGGGCCCTGTGG + Intronic
1049003069 8:139838339-139838361 CTGCTGGACTGCAAGCTCTGGGG + Intronic
1049178894 8:141210313-141210335 CAGCTTTGCTGCGAGCCCTCCGG - Intronic
1049195774 8:141314926-141314948 CAGCTGGCTTTGGAGCCCTGTGG - Intergenic
1050374607 9:4958002-4958024 CAGCTGTCCTTTGAGCCCTGTGG - Intergenic
1051136886 9:13932825-13932847 CAGCTAGACAGCCAACCCTGAGG - Intergenic
1052815049 9:33096050-33096072 CAGCTGTAATGCCAGCCCTTTGG - Intergenic
1056140789 9:83677805-83677827 CAGCGGCACTGCCAGCACTGTGG - Exonic
1061398941 9:130358002-130358024 CAGCTGGCTTGCCAGCCCTGGGG - Intronic
1061551059 9:131334973-131334995 CAGAAGGACTCCCAGCCCTGCGG + Intergenic
1062277901 9:135739342-135739364 CAGCTGGACTGACAGACCTGTGG - Intronic
1062390467 9:136331756-136331778 CAGCGGGGCGGGGAGCCCTGGGG - Intronic
1062419483 9:136472974-136472996 CAGCTCTGCTGGGAGCCCTGGGG - Intronic
1062523459 9:136969092-136969114 CAGATGGGCTGAGGGCCCTGGGG + Intergenic
1062716964 9:138015581-138015603 CAGCTGTGCTGCGTGGCCTGCGG + Intronic
1189214328 X:39310387-39310409 CAGCTAGAATGCCAGTCCTGTGG + Intergenic
1190931136 X:54950603-54950625 CAGCTGGGCTCCGAGCTGTGTGG + Intronic
1200008248 X:153102218-153102240 CCTCTGGACAGTGAGCCCTGAGG + Intergenic
1200171917 X:154083184-154083206 CAGCTGAATTCCCAGCCCTGTGG - Intronic