ID: 1165461127

View in Genome Browser
Species Human (GRCh38)
Location 19:35944975-35944997
Sequence GACTGCGAGCCCTGGGGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 309}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461121_1165461127 -9 Left 1165461121 19:35944961-35944983 CCGTGGTCCAGCTGGACTGCGAG 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461120_1165461127 -4 Left 1165461120 19:35944956-35944978 CCACACCGTGGTCCAGCTGGACT 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461115_1165461127 13 Left 1165461115 19:35944939-35944961 CCCGCGGCGCTCAGGGCCCACAC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461116_1165461127 12 Left 1165461116 19:35944940-35944962 CCGCGGCGCTCAGGGCCCACACC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461114_1165461127 19 Left 1165461114 19:35944933-35944955 CCGGAGCCCGCGGCGCTCAGGGC 0: 1
1: 0
2: 0
3: 18
4: 221
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461110_1165461127 21 Left 1165461110 19:35944931-35944953 CCCCGGAGCCCGCGGCGCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461112_1165461127 20 Left 1165461112 19:35944932-35944954 CCCGGAGCCCGCGGCGCTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 262
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461119_1165461127 -3 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461105_1165461127 29 Left 1165461105 19:35944923-35944945 CCCGCCCGCCCCGGAGCCCGCGG 0: 2
1: 0
2: 7
3: 78
4: 536
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461108_1165461127 25 Left 1165461108 19:35944927-35944949 CCCGCCCCGGAGCCCGCGGCGCT 0: 1
1: 0
2: 6
3: 29
4: 336
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461109_1165461127 24 Left 1165461109 19:35944928-35944950 CCGCCCCGGAGCCCGCGGCGCTC 0: 1
1: 0
2: 2
3: 26
4: 266
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461104_1165461127 30 Left 1165461104 19:35944922-35944944 CCCCGCCCGCCCCGGAGCCCGCG 0: 1
1: 0
2: 8
3: 97
4: 706
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309
1165461107_1165461127 28 Left 1165461107 19:35944924-35944946 CCGCCCGCCCCGGAGCCCGCGGC 0: 1
1: 1
2: 6
3: 73
4: 563
Right 1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461127 Original CRISPR GACTGCGAGCCCTGGGGGCC CGG Exonic
900151512 1:1181037-1181059 GCCTGGGAGCCCAGGTGGCCAGG - Intronic
900290355 1:1921118-1921140 CACTGTGGGCCCTGGGGGGCTGG + Intergenic
900658200 1:3770518-3770540 GACTCAGAGCTCTGGGAGCCGGG + Intronic
900736288 1:4301424-4301446 GACTGCTGGCCTTGGGGGCAGGG + Intergenic
901500857 1:9651974-9651996 TCCTGGGAGCCCCGGGGGCCGGG + Intronic
901838776 1:11940697-11940719 GGCTGAGAGCTCTGGGTGCCAGG + Intronic
902222403 1:14975203-14975225 GAATGCGAGCCCAGGAGCCCTGG - Intronic
902258132 1:15204210-15204232 GAGTGGGAGGACTGGGGGCCTGG - Intronic
902412262 1:16218315-16218337 GAGTGGGGCCCCTGGGGGCCTGG - Intergenic
902448701 1:16483777-16483799 GCCTGGGAGCCCTGGGGGTGGGG - Intergenic
903453411 1:23470470-23470492 CACTGCAAGGCCTGGGAGCCAGG + Intronic
903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG + Exonic
903812983 1:26045388-26045410 GAATGGGAGTCCTGGGGCCCGGG + Intronic
903950697 1:26994363-26994385 GGCTGCGTGCCCTGGGGTGCCGG + Exonic
904358102 1:29954557-29954579 GATTCTGAGCCCTGTGGGCCTGG + Intergenic
904892188 1:33787810-33787832 AACTGCAAACCCTGGGGCCCAGG - Intronic
905356265 1:37387190-37387212 GACTGGGATCCCCAGGGGCCAGG + Intergenic
905365492 1:37449019-37449041 GCCTTGGAGCCCTGGGGTCCTGG - Intergenic
905450902 1:38055509-38055531 GACTGTGAGCTCTGGGGCTCCGG + Intergenic
906637534 1:47419203-47419225 GACTGGGAGCCCTGGGGTGGGGG - Intergenic
919919655 1:202160504-202160526 GACTGGGAGTCCTGTGGCCCCGG - Intronic
922533629 1:226363702-226363724 CACTGCCAGCTCTGGAGGCCTGG + Intronic
922575831 1:226660086-226660108 GGCTGCCAGCCGTGGGGTCCTGG - Intronic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
922937195 1:229431950-229431972 GCCGGCGGGGCCTGGGGGCCGGG + Intronic
924246726 1:242092689-242092711 GACTGCGGGCCCTTGGGCCAGGG - Intronic
1065873219 10:29974024-29974046 GCCTGCGAGCGCTGAGGGGCTGG - Intergenic
1067226763 10:44381705-44381727 GATTGCAAGCCCTGGAGGGCTGG + Intronic
1067233554 10:44427991-44428013 CACTGGGAGCCCTGTGGGCTGGG - Intergenic
1067617039 10:47764017-47764039 GTCTGGGAGCCCTCAGGGCCAGG + Intergenic
1067993495 10:51242577-51242599 GACTGCGAGCCTTGAGGGCAGGG - Intronic
1070575363 10:77673243-77673265 GACTCAGAGCCCTGGGGCCTTGG - Intergenic
1072664473 10:97383862-97383884 GGCTGCGAGCCCTGCGTCCCAGG - Intronic
1072677341 10:97477894-97477916 AACAGCCAGCCCTGGGGGCAGGG + Exonic
1075723997 10:124602571-124602593 GGCTCAGAGCCCTGGGGGACTGG + Intronic
1076463814 10:130664773-130664795 GACTGCCAGCGCTGGAGGCTGGG + Intergenic
1076505588 10:130970841-130970863 GTCGGGGAGCCCTGGGGGACTGG + Intergenic
1076634111 10:131871777-131871799 GGCTGTGAGCCCTGGAGCCCCGG - Intergenic
1076691224 10:132224740-132224762 GGCTGGGATCCCAGGGGGCCTGG + Intronic
1076706473 10:132304795-132304817 GACGGCCCGCCCTGGGCGCCGGG - Intronic
1076707087 10:132307973-132307995 GATTGCGAGCGCTGGGGGCGGGG + Intronic
1077360847 11:2139556-2139578 GGCTGGGGGCCCTGGGGCCCCGG + Intronic
1078571003 11:12457991-12458013 GACTGTGAGCTCCTGGGGCCAGG + Intronic
1078708410 11:13767203-13767225 GATTGCGATTCCTTGGGGCCGGG - Intergenic
1079004130 11:16780591-16780613 CACTGCCAGCCTTGGGGGGCTGG - Intronic
1080855632 11:36109274-36109296 GCCTGCGTGGACTGGGGGCCTGG + Intronic
1083030974 11:59591914-59591936 GACTGAGAGTACTGGGGGCCAGG - Intronic
1083329669 11:61891627-61891649 GTCAGCCAGCCTTGGGGGCCGGG - Intronic
1083652439 11:64211224-64211246 GAGTCCCAGCCCTGGGGGACAGG + Intronic
1083911371 11:65712193-65712215 GACCGAGCGCCCTGTGGGCCCGG - Exonic
1083961813 11:66018769-66018791 GAGGGTGAGGCCTGGGGGCCTGG - Intronic
1084193015 11:67507463-67507485 CTCTGGGAGCCCTGGGCGCCGGG + Exonic
1084323476 11:68386201-68386223 CAAGGAGAGCCCTGGGGGCCTGG + Intronic
1084848909 11:71922648-71922670 GACTAAGAAGCCTGGGGGCCAGG + Intronic
1085010767 11:73140826-73140848 AACTTCGAACCCTGGGGCCCCGG - Intronic
1085041914 11:73331579-73331601 GCCTCCCACCCCTGGGGGCCTGG + Intronic
1085565039 11:77506032-77506054 GACTGGGAGCCCTGCTGGACTGG - Intergenic
1087014535 11:93542956-93542978 GACCGCGAGCCCGCGGGGCCGGG - Intronic
1092172777 12:6384115-6384137 GACAGGGAGCGCTGGGAGCCAGG - Exonic
1092196183 12:6551048-6551070 GACAGGGAGCCATGGGGGCAGGG - Intronic
1096666882 12:53171910-53171932 AACTGCGGGCCCTGGTGGGCTGG - Exonic
1101150162 12:101876975-101876997 GACTGCGCGCCCACGGAGCCGGG - Intergenic
1102676751 12:114664715-114664737 GAGTGGGTGCCCTGGGGGCGGGG + Intergenic
1103202650 12:119100926-119100948 TACTGCAAGCCCTGGAGGGCTGG - Intronic
1103557136 12:121773469-121773491 GGCTGCGGGCCCTGGGGGAGAGG + Exonic
1103944483 12:124518421-124518443 GGCTGGGAGCCTGGGGGGCCTGG - Intronic
1107742309 13:43464410-43464432 GACAGAGAACCCTGGGGACCTGG + Intronic
1108567772 13:51718202-51718224 GACTGCCAGCCCTTGGGAGCAGG + Intronic
1112435088 13:99386147-99386169 GGCTGCGAGCCAGGAGGGCCAGG - Intronic
1113423353 13:110187136-110187158 ACCGGCGAGCCCTTGGGGCCAGG + Exonic
1115576286 14:34714817-34714839 GAGCGCGAGCCCTGCAGGCCGGG + Intronic
1116984442 14:51204146-51204168 GATGGAGAGCCCTGGGGGACGGG + Intergenic
1119421594 14:74510668-74510690 GAGTGGCAGCCCTGAGGGCCTGG + Intronic
1119474736 14:74920479-74920501 GCCTGTGGGCCCTGGTGGCCAGG - Intronic
1120763792 14:88309912-88309934 GACTGAGAGCTCTGGAGGGCAGG - Intronic
1120859347 14:89240884-89240906 GGCTGGGAGTCCTGGGAGCCAGG - Intronic
1121648360 14:95536140-95536162 GCCTTGGAGCCCAGGGGGCCAGG + Intronic
1121733822 14:96204652-96204674 CCCTCTGAGCCCTGGGGGCCAGG - Intergenic
1121824320 14:96998309-96998331 GCCTGCAAGTCCTGGGGGACTGG - Intergenic
1122211641 14:100177863-100177885 GATTGGGAGGCCTGGGGACCTGG - Intergenic
1122524561 14:102371539-102371561 GACAGCCATGCCTGGGGGCCAGG - Intronic
1122713756 14:103680691-103680713 GACAGGGAGGCCTGCGGGCCAGG - Intronic
1122826637 14:104373936-104373958 GCCTTCCAGCCCTGGGGGACGGG + Intergenic
1122899815 14:104777797-104777819 GTCTTCCAGGCCTGGGGGCCAGG + Intronic
1122979439 14:105185052-105185074 GCCTTCCAGCCCTGGGGGACGGG + Intergenic
1124343848 15:28908137-28908159 GACAGGCAGCCCTGTGGGCCTGG + Intronic
1124370807 15:29103736-29103758 GCCTGAGAGCCCTGGAGCCCCGG - Intronic
1125725717 15:41867178-41867200 GACTGTGAGCCCTGCAGGCCAGG - Intronic
1127399649 15:58573222-58573244 GACTGGGAGCCTTGAAGGCCAGG - Intergenic
1127965904 15:63922827-63922849 GAGTGGGAGCTCTGAGGGCCTGG - Intronic
1128533543 15:68471801-68471823 GACTGGTAGCCCTTGGAGCCAGG - Intergenic
1129723252 15:77889203-77889225 GCCTCTGAGCCCTGGGGCCCTGG + Intergenic
1130555122 15:84917328-84917350 AACTGAGTGCCTTGGGGGCCAGG - Intronic
1130901779 15:88212763-88212785 TACTGCTGGCCATGGGGGCCTGG - Intronic
1132117182 15:99145960-99145982 GGGTGCCAGCCCTGGGGGCATGG + Intronic
1132491627 16:234931-234953 GACTGGGGAACCTGGGGGCCGGG - Intronic
1132519223 16:379754-379776 GGCTGTGAGCCCTGGGAGTCGGG - Intronic
1132556385 16:574539-574561 CACTGCCAGCACGGGGGGCCTGG + Exonic
1132589886 16:721992-722014 ACCTGCGAGGGCTGGGGGCCGGG + Intronic
1132756648 16:1488475-1488497 AACTGGGGGCCATGGGGGCCGGG - Intronic
1133274074 16:4626037-4626059 GCCTGGGACCCCTTGGGGCCTGG + Intronic
1134218308 16:12333643-12333665 GACTGGGAGCCCTGGGGAAGAGG - Intronic
1135547611 16:23376580-23376602 GCCTGGGAGCCCTGGCGGTCTGG + Intronic
1136220407 16:28824099-28824121 GACTGGGAGGACTGCGGGCCGGG + Intronic
1136380853 16:29894813-29894835 GACTGCGACCCTGGGGGGCAGGG - Intronic
1136634010 16:31507979-31508001 GACTCGGAGCCCGGGGGGCGGGG - Intronic
1137748578 16:50841695-50841717 GACCACAAGCCCTGGGCGCCGGG - Intergenic
1138550199 16:57743684-57743706 CACTGCGAGGCCTGGGAGGCTGG - Intronic
1141605811 16:85152695-85152717 GAAAGGGAGCCCAGGGGGCCAGG - Intergenic
1141658159 16:85427119-85427141 CACTGTGAGTCCTGGGGTCCTGG + Intergenic
1141819940 16:86438415-86438437 GACTGCGTGCCGTGGGTACCTGG + Intergenic
1142129347 16:88425712-88425734 GCCTGGGAGTCCTTGGGGCCAGG - Intergenic
1142335887 16:89489821-89489843 GCCTGGGGGCCGTGGGGGCCCGG - Intronic
1142353551 16:89590763-89590785 GACTGGGGGACATGGGGGCCGGG + Intronic
1142353568 16:89590802-89590824 GACTGGGGGACATGGGGGCCGGG + Intronic
1143470769 17:7173903-7173925 GCCTTCGCGCCCTGGGGCCCTGG - Intronic
1143500646 17:7336692-7336714 GCCAGCGGGCCCTGGAGGCCGGG - Exonic
1143639262 17:8186300-8186322 CACTGTGCGCCCTGGAGGCCAGG - Intergenic
1143697317 17:8630317-8630339 GAGGGCGACCCCTGGGGGGCTGG - Intronic
1144776505 17:17787638-17787660 GACTGTGGGCCCTGCGGCCCAGG + Intronic
1144930894 17:18858114-18858136 GACTGCGAGGCCGGTGGGCGGGG - Exonic
1145274623 17:21422233-21422255 GGCTGCGAGCTCTGCGGGGCAGG + Intergenic
1145312473 17:21708131-21708153 GGCTGCGAGCTCTGTGGGGCAGG + Intergenic
1145756751 17:27397618-27397640 GACTGCGAGACCTCAAGGCCAGG + Intergenic
1148139212 17:45316720-45316742 GAGTGCGCGGCCTGGAGGCCCGG + Intronic
1150144160 17:62753818-62753840 GGCTGGGAGCCCTGGAGGGCAGG + Intronic
1150294767 17:64001848-64001870 GACTGCCAGCCATGGGCACCGGG - Exonic
1150747107 17:67825358-67825380 GGCGGGGAGCCCTGGGCGCCTGG - Intergenic
1151333407 17:73424695-73424717 GAGTGCCAGCCCTGGGGGGCAGG + Intronic
1152092016 17:78252397-78252419 GACTGAGGGCCCTGTGGGGCTGG - Intergenic
1152305729 17:79519254-79519276 GAGTGTGAGCCCTGGGGGTGGGG - Intergenic
1152480525 17:80548722-80548744 GACTGTGTGGCCTGGAGGCCTGG - Intronic
1152753618 17:82077832-82077854 GACAGGGAGCCCTGGGCACCTGG - Intergenic
1154173794 18:12068500-12068522 GGCTGTGAGGCCTGGGGCCCGGG - Intergenic
1160012363 18:75115798-75115820 GACTGAGAGCCCTGGAGGACAGG + Intergenic
1160340783 18:78087120-78087142 ACCGGCGTGCCCTGGGGGCCTGG + Intergenic
1160824045 19:1071244-1071266 GACCGCGAGCGCGTGGGGCCTGG - Intronic
1160853990 19:1207779-1207801 GGCTTCCAGCCCCGGGGGCCAGG - Intronic
1160965491 19:1745407-1745429 GGCTGCCAGGCCTGGGGGCAGGG - Intergenic
1160984937 19:1834107-1834129 GTCTTAGAGCCCTGGGGTCCAGG - Intronic
1161009473 19:1953347-1953369 GCCTGTGCGCCATGGGGGCCTGG + Intronic
1161574305 19:5047406-5047428 ACCTGCGAGCCCTGGGGTGCAGG - Intronic
1161591186 19:5129798-5129820 CACCGTGAGCCCTGGGGCCCTGG - Intronic
1161772546 19:6238906-6238928 GGCAGCGAGCCCTGTGGGGCTGG + Intronic
1161856112 19:6766686-6766708 GACTGCAAGCTCTGGAGGGCAGG - Intronic
1162011053 19:7815388-7815410 GTGTGCGAGCCCAAGGGGCCAGG + Intergenic
1162818830 19:13210845-13210867 GACGCCCAGCCCCGGGGGCCTGG - Intronic
1162896696 19:13768745-13768767 GACGGTAAGCCCTGGGGGCGGGG + Intronic
1162964878 19:14150996-14151018 GCCCGCCAGCCCTGGTGGCCCGG - Exonic
1163724085 19:18912773-18912795 GACTGCCAGGCCAGGGGGCCTGG - Intronic
1164758706 19:30710689-30710711 TCCTTTGAGCCCTGGGGGCCAGG + Intronic
1165461127 19:35944975-35944997 GACTGCGAGCCCTGGGGGCCCGG + Exonic
1165894478 19:39133461-39133483 GACTGAGAGCCTGGGGGACCTGG + Intronic
1166310622 19:41960364-41960386 GAATTCCAGCCCTGTGGGCCAGG - Intergenic
1167098500 19:47389316-47389338 CACAGAGAGCCCTGTGGGCCGGG + Intergenic
1167124370 19:47539147-47539169 GACTAGGAGCCCTGGGAGGCAGG + Intronic
925028920 2:634305-634327 TGCTGCTATCCCTGGGGGCCGGG - Intergenic
925893381 2:8453893-8453915 GACTGAGAGCTCTGGGGGGTGGG - Intergenic
926077302 2:9951654-9951676 GGCTGCGCGCACTGGGCGCCGGG - Intergenic
927511661 2:23647853-23647875 GACTGTGAGCCCCGGGGTCAGGG + Intronic
929599321 2:43195038-43195060 GCCTCCGAGCGCTGGGGGCGGGG + Intergenic
929604153 2:43224443-43224465 GACAGCGAGTCCGGGGGGCTGGG + Exonic
929779676 2:44949606-44949628 GACTTCGAGCTCCGGGGTCCCGG - Intergenic
929929135 2:46238606-46238628 GATTGTGAGCCCTGGGGTCAGGG - Intergenic
930152621 2:48074086-48074108 GACTGCTGGCCGTGGGGGCAAGG + Intergenic
930667631 2:54115511-54115533 GACTGCGGGGCCTGGGAGCGAGG - Exonic
930845085 2:55895180-55895202 GTCTTGGAGCCCTGGGAGCCTGG - Intronic
931251431 2:60534197-60534219 CACTGGGAGCCCAGGGAGCCTGG + Intronic
932620246 2:73260777-73260799 ACCTGCGGGCCCTGGGGGTCGGG - Exonic
934856483 2:97733258-97733280 GACAGTGAGGGCTGGGGGCCAGG - Intronic
937235975 2:120432251-120432273 GGAGGTGAGCCCTGGGGGCCGGG - Intergenic
938116872 2:128608283-128608305 GACTTGGTGCCCTCGGGGCCAGG - Intergenic
938808792 2:134832228-134832250 GGCTCAGAGCCCTGTGGGCCAGG + Intergenic
939094273 2:137816032-137816054 GACTGCAAGTCCTGGGTGTCGGG + Intergenic
947603107 2:231466637-231466659 GACTGGGAGGCCTAGGGGACAGG - Intronic
947633849 2:231670336-231670358 GCCTGGAAGCCCTGGGGCCCAGG - Intergenic
948207114 2:236168194-236168216 TCCGGCGAGCCCTCGGGGCCCGG - Exonic
948564800 2:238877925-238877947 TACTGGGTGCACTGGGGGCCAGG + Intronic
948808619 2:240463562-240463584 GACTGGGGGTCCTGGGGGGCGGG + Intronic
948888723 2:240896728-240896750 GACTGGTAGCCCAGGGGTCCAGG - Intronic
1168904527 20:1392750-1392772 GCCGTCGAGGCCTGGGGGCCCGG - Intronic
1169001275 20:2169553-2169575 GACTGCAAGTCCAGGGGTCCAGG + Intronic
1169409960 20:5359943-5359965 GTCTGGAAGCCCTGGGGGCATGG - Intergenic
1169531474 20:6489751-6489773 GACTGCAGGCCCCAGGGGCCAGG - Intergenic
1172413014 20:34740567-34740589 GACCTCTAGCCCTGTGGGCCCGG - Exonic
1173660094 20:44727265-44727287 GACTGCGACCCCTGGAGGGTGGG - Exonic
1173690946 20:44960461-44960483 GCCTGCGAGACCTGGAGGCCCGG + Exonic
1175214637 20:57385402-57385424 CACTGCCTGCCCTGGGAGCCCGG - Intergenic
1175527595 20:59646198-59646220 TAGTGGGAGCCCTGGGGCCCTGG + Intronic
1175847447 20:62066041-62066063 GGCTGCGAGCGCTAGAGGCCGGG + Intergenic
1175860921 20:62149560-62149582 GAATGTGAGCCCAGGAGGCCCGG - Intronic
1176038087 20:63050053-63050075 CCCTGCAAGCCCTGGGGGCGTGG - Intergenic
1176042291 20:63072137-63072159 GACGGCGGGGCCTGGGGGCGCGG - Intergenic
1176100286 20:63361499-63361521 GACCGCGCGCCCAGGGGGACGGG + Intronic
1177401781 21:20614286-20614308 GACAGCTTGCCCTGTGGGCCTGG + Intergenic
1178702260 21:34843843-34843865 GACAGTGAGCCCTGGCGACCGGG - Intronic
1179150533 21:38805504-38805526 GAGTGTGCGCCCTGGGAGCCGGG - Exonic
1179192706 21:39136933-39136955 GACTGTCAGCCCTGGAGGGCAGG + Intergenic
1179399727 21:41072701-41072723 CACTGCGAGCTCTGTGGGGCAGG - Intergenic
1180607118 22:17067193-17067215 CACTGGGAGCCCTTGGGGTCAGG - Intergenic
1180955003 22:19737642-19737664 GGCTGAGGGCCCTGGGGGGCAGG - Intergenic
1180959317 22:19755504-19755526 GACTCCCAGCCCTCGGGGGCGGG - Intergenic
1181107033 22:20581647-20581669 GCCTGCCAGCCCTGGGCGTCTGG - Intronic
1182576530 22:31276737-31276759 CACTGCCTGGCCTGGGGGCCGGG - Intronic
1183479051 22:38052872-38052894 GACTGCGATTCCCAGGGGCCTGG + Intergenic
1183483561 22:38077652-38077674 GACTCCGTCCCCTGGGGTCCTGG - Intergenic
1183953958 22:41368306-41368328 GAGTTGGAGCCCTGGGGACCTGG - Intronic
1184036278 22:41919827-41919849 CATCCCGAGCCCTGGGGGCCTGG - Intergenic
1184100989 22:42341740-42341762 GACTGGGAGAGCTGGGGCCCGGG - Intronic
1184237023 22:43187807-43187829 GCCTGCGAGCTCTGTGTGCCCGG - Intergenic
1184392420 22:44212101-44212123 GCCTGGGGGCCCTGGGTGCCTGG + Intronic
950569915 3:13793438-13793460 GAGAGCGAGCCTTGCGGGCCTGG - Intergenic
953099168 3:39809201-39809223 GCCTCTGAGTCCTGGGGGCCCGG - Intronic
953407833 3:42668347-42668369 GGCTGACAGGCCTGGGGGCCTGG + Intergenic
953906925 3:46873043-46873065 GACGGCGAGCCCTTGAGGACAGG - Intronic
954337731 3:49929579-49929601 GACTGCCAGCCCACGTGGCCTGG - Intronic
957637731 3:82808132-82808154 GAGTAGGAGACCTGGGGGCCGGG - Intergenic
959883561 3:111473786-111473808 GACTGAGATCCCTGGGGGGAGGG - Intronic
960141857 3:114158936-114158958 CACTGAGAGCCCTGGGGGAAAGG - Intronic
961649839 3:128411792-128411814 AACGGGAAGCCCTGGGGGCCTGG + Intergenic
963049273 3:141127775-141127797 AGCTGGGAGCCCTGGGTGCCTGG - Intronic
963286987 3:143442874-143442896 AACTGCCAGCCCATGGGGCCCGG + Intronic
963975976 3:151480949-151480971 GACTGAGGTCCCTGGGGGACAGG - Intergenic
965593568 3:170385510-170385532 GATTGAAAGCTCTGGGGGCCAGG + Intronic
967889545 3:194355328-194355350 GAGTGTGAGCCCTGGTGGGCAGG - Intronic
968057729 3:195705509-195705531 GCCTCTGAGCCCTGTGGGCCTGG - Intergenic
968534406 4:1113968-1113990 GCGTGGGGGCCCTGGGGGCCCGG + Intergenic
968944510 4:3656531-3656553 GACCGTGAGCCCTGGGGCGCAGG + Intergenic
968949179 4:3681634-3681656 GGCTGCCAGCCCTGTGGGCCAGG - Intergenic
969272853 4:6114535-6114557 ACCTGCTAGCCCTGGGGCCCTGG + Intronic
969296572 4:6273642-6273664 CACTGTGAGCCCTGAGGGCAGGG - Intronic
969462154 4:7334468-7334490 GACAGTGAGCTCTGAGGGCCAGG + Intronic
969513549 4:7633381-7633403 GACTGGTAGACCTGGGGGACGGG - Intronic
969652272 4:8474867-8474889 GCCTGCGAGGCCTGGGACCCAGG + Intronic
972675510 4:41256753-41256775 GACTGCAAGGTTTGGGGGCCCGG + Intronic
982241754 4:153306828-153306850 GACTGGGAGCCTGGGAGGCCAGG - Intronic
983095160 4:163552736-163552758 GAATGAGGGCTCTGGGGGCCTGG + Intronic
985710817 5:1428639-1428661 GGCTGGGACCCCTGGGGGCCAGG + Intronic
985808803 5:2068347-2068369 GGCTGCCAGCCCAGGGGTCCAGG + Intergenic
985827656 5:2204930-2204952 GACTGGCAACCCTGTGGGCCTGG + Intergenic
985908797 5:2863370-2863392 GAATGTGGGCCCTGGGGGCCAGG + Intergenic
986177645 5:5365433-5365455 GACTGTGGGGCCTGTGGGCCTGG + Intergenic
991722135 5:69503501-69503523 GACAGCCAGCGCTGGGGTCCTGG - Intronic
992530216 5:77645658-77645680 CGCTGCGCCCCCTGGGGGCCGGG - Intergenic
997237275 5:132280115-132280137 GAGAGAGAGCCCTGGGGGCTGGG - Intronic
997261854 5:132471431-132471453 GTCTGGGAGCTCTGGGGCCCAGG - Intronic
997452628 5:133995912-133995934 GACTGGGAGGGGTGGGGGCCAGG - Intronic
998474367 5:142408190-142408212 CACTGGGAGCTCTGGAGGCCAGG + Intergenic
1000240534 5:159404343-159404365 GGCTGAGAGCCCTGGGGGTGTGG + Intergenic
1001631281 5:173177536-173177558 GGCTGAGGGCCCTGGGGGCCGGG - Intergenic
1002091602 5:176809938-176809960 GCCTGCCAGCTCTGGTGGCCAGG + Intergenic
1002460760 5:179372486-179372508 GGCTGCCAGCCCTGGGCCCCGGG + Intergenic
1002637283 5:180614668-180614690 ACCTGGGAGCCCTGAGGGCCAGG + Intronic
1003179989 6:3783121-3783143 GACAGAGAGTCCTGGGAGCCAGG - Intergenic
1004868122 6:19874221-19874243 GACTGTGAGATCTGGGGGGCAGG + Intergenic
1005826092 6:29632648-29632670 TTCTGCGAGCCGCGGGGGCCGGG - Intronic
1006196197 6:32243964-32243986 GACTGGGAGCCTTGGAGGGCAGG - Intergenic
1006456956 6:34137307-34137329 GAATGAGAGCCCTGAGGGGCAGG + Intronic
1006624425 6:35387180-35387202 GACAGCAACCCCTGGGGGCCTGG - Intronic
1006815815 6:36849119-36849141 GCAGGCGAGCCCTGGGGGCAGGG - Intergenic
1006933775 6:37703473-37703495 GACTACGGGCCCTTAGGGCCAGG - Intergenic
1007091910 6:39190064-39190086 GACTGCTAGGGCTGGTGGCCAGG - Exonic
1007095148 6:39208355-39208377 GAATGAGCTCCCTGGGGGCCCGG - Intronic
1007757013 6:44106253-44106275 GACTGTCAACCCTTGGGGCCAGG + Intergenic
1007924416 6:45640113-45640135 GACAGCTAGCCCTGGGCCCCAGG - Intronic
1007960892 6:45957950-45957972 GATTTTGAGCACTGGGGGCCAGG + Intronic
1008418887 6:51273747-51273769 GAATGCAAGCCCTCAGGGCCTGG - Intergenic
1011754321 6:90483536-90483558 CTCTGCCAGCCCTGAGGGCCTGG + Intergenic
1012647076 6:101699163-101699185 TACTGCCAGACCTGGGGTCCTGG + Intronic
1012916781 6:105179630-105179652 AACTCCGCGCCCTGGGGTCCGGG - Intronic
1018203809 6:161417979-161418001 GTCAGCCAGGCCTGGGGGCCAGG - Intronic
1018386469 6:163308795-163308817 GAAAGCGAGCCCTGGCGGCCTGG - Intronic
1019198639 6:170296610-170296632 ACCTCGGAGCCCTGGGGGCCGGG + Intronic
1019268832 7:134575-134597 GACTGAGAGACCTGGGGCTCGGG - Intergenic
1019268845 7:134628-134650 GACTGAGAGACCTGGGGCTCGGG - Intergenic
1019275953 7:175777-175799 GGCTGGGAGCCCGGGGAGCCTGG + Intergenic
1019512744 7:1426134-1426156 GAATGGCAGTCCTGGGGGCCGGG - Intergenic
1019569636 7:1704859-1704881 GACCTCGAGCCCTGGTGGACAGG - Intronic
1021103869 7:16615278-16615300 CCCTGAGAGCCCCGGGGGCCTGG - Intronic
1021126138 7:16852754-16852776 AACTGAGAGACTTGGGGGCCAGG - Intergenic
1021414574 7:20367459-20367481 TACTGCGAGCCCTAGGAGCAAGG + Intronic
1022559853 7:31336672-31336694 CAGTGGGCGCCCTGGGGGCCGGG - Intergenic
1023014808 7:35956170-35956192 GCCTGCCTGCCCTGGGTGCCTGG - Intergenic
1024066197 7:45738850-45738872 GCCTGCCTGCCCTGGGTGCCTGG + Intergenic
1025217340 7:57070005-57070027 GCCTGCCCGCCCTGGGCGCCTGG + Intergenic
1025628257 7:63243658-63243680 GCCTGCCCGCCCTGGGCGCCTGG + Intergenic
1025654008 7:63500460-63500482 GCCTGCCCGCCCTGGGCGCCTGG - Intergenic
1027270008 7:76513891-76513913 GACAGCCAGCCCTGGGGTCGAGG + Intronic
1029597130 7:101543912-101543934 GGCTGACAGCCCAGGGGGCCAGG + Intronic
1032082930 7:128869162-128869184 GGCTGCGGGCCCTCGGGGCCAGG - Intronic
1032119448 7:129145419-129145441 GACTTTCAGGCCTGGGGGCCTGG + Intronic
1033570592 7:142624717-142624739 GACTGCCAGCCCTGCTGACCAGG - Intergenic
1034267712 7:149789287-149789309 GCCAGCAAGCCCTGGGGGCACGG - Intergenic
1034878816 7:154748565-154748587 CCCTGCGAGCCCTGCGGGGCGGG + Intronic
1035203161 7:157279435-157279457 GACTCCGAGCCCTGGGCCCCGGG - Intergenic
1036001146 8:4606408-4606430 CACTGTGAGCCCAGGGAGCCAGG - Intronic
1037784138 8:21892651-21892673 CACTGAGAGTCCTGGGGGCCAGG + Intergenic
1037860424 8:22401315-22401337 GTGTCCGAGCCCTGGGTGCCTGG + Intronic
1037890149 8:22619765-22619787 GAGAGCGAGACCTGGGAGCCAGG + Exonic
1041829948 8:62143191-62143213 GCCCGCGAGCCCCGGGGGCTGGG - Intergenic
1042156975 8:65854571-65854593 GAATGCGAGCACTGGGAGACTGG - Intergenic
1044734795 8:95268737-95268759 GACTGCGGGCTCTGCGGGCGGGG + Intronic
1047259236 8:123241179-123241201 GAGGGCGAGGCCTGGGGCCCGGG + Intronic
1049247629 8:141571256-141571278 GACTGTGAGCCCTGGGTCTCAGG - Intergenic
1049319452 8:141988247-141988269 GAGTACGAGCCCTGGGAGGCTGG + Intergenic
1049576815 8:143393468-143393490 GCCTGCTGGCCCTGAGGGCCGGG - Intergenic
1049604067 8:143521019-143521041 AGCTGAGAGCCCTGTGGGCCGGG - Intronic
1049762324 8:144337034-144337056 GGCTGCGGGCTCTGGAGGCCGGG - Intergenic
1049776730 8:144409422-144409444 GACAGCGGGCCCTAGTGGCCCGG + Intergenic
1052882907 9:33615834-33615856 GACTGCCAGCCCTGCTGACCAGG - Intergenic
1054160897 9:61671565-61671587 GACTGCCAAGCCTCGGGGCCTGG + Intergenic
1054804129 9:69381606-69381628 GACTGAGAGCCATGGGGATCTGG + Intronic
1055573418 9:77639985-77640007 GACTGGGATCCCTGTGAGCCAGG - Intronic
1060222397 9:121771694-121771716 GACGGAGAGCAGTGGGGGCCTGG - Intronic
1060549113 9:124476854-124476876 CCCTGGGAGCACTGGGGGCCTGG + Intronic
1060970530 9:127735041-127735063 CGCTGGGAGCCCTGGGAGCCCGG - Intronic
1061808030 9:133147404-133147426 GACTGCCAGCTCTGGAGGGCAGG + Intronic
1061921988 9:133787554-133787576 CACTGCCAGCCCTGGAGGCCAGG + Intronic
1062020075 9:134315225-134315247 GACAGCCAGCTCTCGGGGCCAGG - Intergenic
1062334312 9:136058322-136058344 CACTGGGAGCCGTGGGGACCGGG - Intronic
1062491055 9:136805105-136805127 CACTGTGAGCACTGTGGGCCCGG - Intronic
1062625970 9:137441650-137441672 GGCTGCGGGCCGTGGGGGGCGGG - Intronic
1062627316 9:137449186-137449208 GGCTGCAGTCCCTGGGGGCCGGG - Exonic
1189308605 X:40005403-40005425 GCGGGCGAGCCCTGGGTGCCAGG + Intergenic
1190245850 X:48689462-48689484 CAGTGCTAGCCCTGGGAGCCAGG - Intronic
1192194332 X:69018490-69018512 GACAGGAAGCTCTGGGGGCCAGG + Intergenic
1195243739 X:102978199-102978221 TACTTCGAGCACTGGAGGCCTGG + Intergenic
1197754537 X:129984392-129984414 GACGAGGAGCCCCGGGGGCCGGG + Intronic
1200178980 X:154138953-154138975 GTCTGCGAGCTGTAGGGGCCAGG - Intergenic