ID: 1165461130

View in Genome Browser
Species Human (GRCh38)
Location 19:35944989-35945011
Sequence GGGGCCCGGCCACGAACCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461115_1165461130 27 Left 1165461115 19:35944939-35944961 CCCGCGGCGCTCAGGGCCCACAC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1165461119_1165461130 11 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1165461120_1165461130 10 Left 1165461120 19:35944956-35944978 CCACACCGTGGTCCAGCTGGACT 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1165461121_1165461130 5 Left 1165461121 19:35944961-35944983 CCGTGGTCCAGCTGGACTGCGAG 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1165461123_1165461130 -2 Left 1165461123 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 3
3: 40
4: 294
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1165461116_1165461130 26 Left 1165461116 19:35944940-35944962 CCGCGGCGCTCAGGGCCCACACC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461130 Original CRISPR GGGGCCCGGCCACGAACCTG TGG Exonic
900173581 1:1282077-1282099 GGGGCCCTGCCGCTGACCTGTGG + Intronic
900349345 1:2227519-2227541 GGGGCCACGCCACGCACCCGGGG - Intergenic
900467989 1:2835130-2835152 GGGGCCCTGCCAGGAAGCCGTGG + Intergenic
900633242 1:3649778-3649800 GGGGCCCGGGCAGGTACCCGGGG - Intronic
900635684 1:3663961-3663983 GGGGGCCGGCCACGACCCCCAGG - Intronic
902984700 1:20148474-20148496 GGAGCCAGGCCAGGAGCCTGAGG + Exonic
904625043 1:31797806-31797828 GGGGCCCCTCCCCCAACCTGGGG + Intronic
905580891 1:39082009-39082031 GGGGCGCGCCCGCGAGCCTGGGG - Intronic
906288796 1:44605893-44605915 GGGCACCGGCCACTACCCTGGGG + Intronic
906640757 1:47439154-47439176 CGGGCCCGGGCCCGAGCCTGAGG - Exonic
914373485 1:147051346-147051368 GGAGCAAGGCCACGACCCTGGGG + Intergenic
914900052 1:151706974-151706996 TGGGCTCGGCCAGGAAGCTGAGG - Intronic
916464731 1:165062592-165062614 GAGGACTGGCCACGACCCTGGGG + Intergenic
923626280 1:235616398-235616420 AGGGCCCTGCCAGGAGCCTGTGG + Intronic
1074404140 10:113165909-113165931 GGGTCCCGGCCAGGGAGCTGTGG - Exonic
1077065570 11:639642-639664 CGGCCACGGCCACGAACCTGCGG - Exonic
1077309767 11:1883102-1883124 GAGGCCCAGCCACAAAGCTGGGG + Intronic
1080458194 11:32433693-32433715 GCGGCGCGGACCCGAACCTGCGG - Intronic
1084172591 11:67407673-67407695 GGGGCCAGGCCAAGAACAGGAGG + Intronic
1089499829 11:118925532-118925554 GGGTCTCGGCCCCGAACCTCAGG + Intronic
1089637458 11:119824528-119824550 GAGGCCTTGCCAGGAACCTGGGG + Intergenic
1091206418 11:133824414-133824436 GGGGCCTGGCCACAGAGCTGTGG - Intergenic
1092171116 12:6374675-6374697 GGGGCTGGGCCCCGAACCTGCGG - Exonic
1096647657 12:53047368-53047390 GCGGCGCGGCCACTCACCTGCGG - Intronic
1101094808 12:101327162-101327184 GGGTCCCGGCCAGGAACCGCAGG - Exonic
1103702490 12:122855166-122855188 GGGGCCCAGCCAGGTGCCTGGGG - Intronic
1104000350 12:124856110-124856132 GGGGCCAGGCCCAGCACCTGGGG - Intronic
1108541591 13:51452039-51452061 GGGTCCCGGGCACGGAGCTGCGG + Exonic
1112506821 13:99980739-99980761 GGGGCCCGGCCTCGAGCTGGAGG + Intergenic
1113584898 13:111458406-111458428 GGGGCCAGGCCTGGAACGTGGGG - Intergenic
1115163697 14:30424484-30424506 AGGGCCTGGCCATGAAGCTGTGG + Intergenic
1119781683 14:77280173-77280195 GGAGCCTGGACACGAACCTCAGG + Intronic
1121122246 14:91383322-91383344 GGGGCCCAGCCAGGAATCTCAGG + Intronic
1122193491 14:100067142-100067164 GGTGCCAGGCCAGGGACCTGTGG - Intronic
1122632265 14:103112401-103112423 GGGGCCCGGCTTAGACCCTGAGG + Intergenic
1123939095 15:25208200-25208222 GTGGCCCTGCCACGGACCTCAGG - Intergenic
1125768653 15:42151050-42151072 GGGGCCCTGCCCAGAGCCTGTGG + Intronic
1129446999 15:75625637-75625659 GGGGCCCGGGCTCGAACCCAGGG + Exonic
1131283026 15:91035906-91035928 GAGGCCCTGCCATGGACCTGGGG - Intergenic
1133239335 16:4405132-4405154 GGGGCCTGGCCCAGCACCTGCGG + Intronic
1135425916 16:22335814-22335836 GGGGGCTGGCCTAGAACCTGGGG - Intergenic
1135592097 16:23712107-23712129 GTGGCCCAGCCCCAAACCTGAGG - Intronic
1139393616 16:66622248-66622270 GGGGCCAGGCCACGTGCCCGAGG - Intronic
1142200929 16:88760810-88760832 GGAGCCCGGCCAGCAGCCTGGGG + Intronic
1142826939 17:2519234-2519256 CGTGCCCGGCCAGGAAACTGTGG - Intergenic
1144734061 17:17545090-17545112 GTGGCCCGGCAAGGACCCTGAGG - Intronic
1145398436 17:22513371-22513393 GGGGCAGGGCCAGGAGCCTGCGG + Intergenic
1145811801 17:27768825-27768847 GGGCCAGGGCCACAAACCTGAGG - Intronic
1148156404 17:45427403-45427425 GAGGCACAGCCACGATCCTGGGG - Intronic
1148384971 17:47227933-47227955 GGGGCCCTTCCACCACCCTGAGG + Intergenic
1151681772 17:75626223-75626245 GAGGCCTGGCCACTCACCTGTGG - Intergenic
1152405637 17:80096495-80096517 GGGGCCGGGCTAGGAAGCTGAGG - Intronic
1152929284 17:83101690-83101712 GGAGGCCGGCCAGGGACCTGGGG + Intergenic
1160693447 19:470908-470930 GGGGCAAGGCCACCAGCCTGTGG + Intronic
1160711322 19:552489-552511 GGGGAGCGGCCAGGAGCCTGGGG - Intergenic
1161065036 19:2233334-2233356 GGGGCCATGCCACCAGCCTGGGG + Exonic
1161238116 19:3207929-3207951 GGGGCCAGGCTACGGACTTGCGG + Exonic
1161610607 19:5240307-5240329 CGGGCCAGCCCATGAACCTGCGG - Exonic
1161668310 19:5590261-5590283 GGGGCTCACCCACTAACCTGGGG + Exonic
1162018009 19:7856125-7856147 GGGGCATGGCCGCTAACCTGGGG + Intronic
1163795933 19:19337983-19338005 GGGGGCCGGCCACCCGCCTGAGG - Intronic
1165436173 19:35796794-35796816 GGGGCCCGGCCAGGCTCCTGCGG - Intergenic
1165461130 19:35944989-35945011 GGGGCCCGGCCACGAACCTGTGG + Exonic
1166181616 19:41113005-41113027 GGTGCACACCCACGAACCTGTGG + Intergenic
1166948972 19:46413710-46413732 GGGGCGCGGCCACACCCCTGTGG - Intergenic
925654151 2:6126802-6126824 GGGGCCAGGCCTGGAACGTGTGG - Intergenic
929537275 2:42791765-42791787 GGGGCCCCGCCATGGAACTGGGG + Intronic
929613265 2:43287745-43287767 TGGGCCCAGCCAAGAATCTGGGG - Intronic
933748157 2:85585499-85585521 GAGGCCAGGCCAGGAAGCTGAGG + Intronic
933994686 2:87659670-87659692 GGGTCTCGGCCAGGAACGTGAGG + Intergenic
938380163 2:130832050-130832072 GGAGCCTGGCCACGGTCCTGCGG + Intergenic
938496647 2:131801486-131801508 GGGGCCGGGCCACCAGCGTGCGG + Exonic
939178683 2:138780472-138780494 GGGGGCCGGCAAAGAGCCTGCGG + Intergenic
946573382 2:221048716-221048738 TGGGCCTTGCCAGGAACCTGGGG - Intergenic
948619961 2:239228076-239228098 AGGGCAGAGCCACGAACCTGGGG + Intronic
948824360 2:240567145-240567167 GGGACACGGCCACGATCTTGGGG - Intronic
1175108859 20:56631632-56631654 CGGGCCTGGCCGAGAACCTGGGG + Exonic
1175924642 20:62465817-62465839 AGGGCCTGGCCACGCACCTGAGG + Exonic
1178695737 21:34792013-34792035 TGGGCCCGGCCACCGTCCTGGGG - Exonic
1178701192 21:34835078-34835100 GGGGCCCTACCACTAAGCTGCGG - Intronic
1180209406 21:46285895-46285917 AGGGCGCTGCCACGAAGCTGAGG + Intronic
1180232729 21:46437097-46437119 GGAGCCAGGCCAGGGACCTGGGG - Intronic
1180951024 22:19720686-19720708 GGGGCCTGGCCAGGGCCCTGGGG + Intronic
1182605054 22:31496632-31496654 AGGGCCGGGCCTCGTACCTGGGG - Exonic
1183347934 22:37318270-37318292 GGGCCCCTGCCAGGTACCTGGGG + Intergenic
1185268539 22:49917988-49918010 GGGGCCCGACCTCTCACCTGGGG - Intronic
1185288960 22:50014625-50014647 GGGGCCCGCCCAGGAGCCCGTGG - Intergenic
1185418100 22:50720868-50720890 CGGGCCCGGCCAAGGACCGGCGG + Intergenic
950023770 3:9806967-9806989 AGGGCCCGGCCAGGAAGCTCTGG - Intronic
950055051 3:10017710-10017732 TGGGCCAGGCCAGGAGCCTGAGG + Intergenic
953036276 3:39213804-39213826 GGGGACTGGCCAGGAATCTGTGG + Intergenic
954025699 3:47781669-47781691 GGGGCCCGGCCACCAAGTTTTGG - Exonic
954648914 3:52148250-52148272 GGGGCCAGGCCAGCAAACTGGGG - Intronic
968474104 4:795082-795104 AGGGACCCGCCGCGAACCTGGGG + Intronic
969409145 4:7016430-7016452 GGGCCCCAGCCAGGAATCTGAGG - Intronic
981081501 4:140643102-140643124 GGGACCCGCTCAAGAACCTGCGG - Intronic
999727050 5:154446115-154446137 GGGGCCCGGCCTCGAACCCGCGG - Exonic
1001760381 5:174203453-174203475 TGGGCCCTGCCACGAATCTGGGG + Intronic
1001801269 5:174546110-174546132 CGTGCCCTGCCAAGAACCTGCGG - Intergenic
1002431956 5:179208895-179208917 GGGGCCTGGCCACCGCCCTGTGG - Intronic
1002927315 6:1611816-1611838 GGAGGCCGGCCACCACCCTGCGG + Exonic
1003324841 6:5084309-5084331 GGGGCCAAGGCCCGAACCTGAGG - Intergenic
1005875361 6:30006827-30006849 GCGGCCCGGCCAGGAAACGGCGG - Intergenic
1006606329 6:35259966-35259988 GGGGCCCGGCCGCGGTCCAGCGG - Intronic
1018936467 6:168277054-168277076 TGGGTCCGGCCACGCAGCTGCGG + Intergenic
1019354156 7:570233-570255 AGGGCCCTGCCACGAGCCTGCGG - Intronic
1022522203 7:31015679-31015701 GGGGACCTGCCAGGAAGCTGTGG - Intergenic
1024013122 7:45287604-45287626 GGGACCCGGCCCCTAACCTATGG - Intergenic
1029197353 7:98814855-98814877 GTGGCCCAGCCAGGAACATGGGG + Intergenic
1029402320 7:100353785-100353807 TGGGCCTGGCCAGGCACCTGTGG - Intronic
1033366272 7:140674212-140674234 GGTCCCTGGCCACCAACCTGAGG + Exonic
1035265709 7:157689430-157689452 GGGGCCCCGCCACAGCCCTGAGG - Intronic
1035299644 7:157888492-157888514 GGGGCCCCGTCAGGAACGTGTGG + Intronic
1045516224 8:102863406-102863428 GGGGCCCGGCCGCAGCCCTGAGG - Intronic
1047903501 8:129448940-129448962 CGCGCCCGGCCAGGAATCTGTGG + Intergenic
1049209285 8:141377945-141377967 GGGGGCCGGCCACCACCGTGTGG + Intergenic
1049573355 8:143379645-143379667 GGGGGCTGGTCAGGAACCTGGGG + Intronic
1051591049 9:18777121-18777143 AGGGCCGGGCCACGAGCTTGCGG - Exonic
1051591086 9:18777261-18777283 GGGGCCTGGCCGCCAACCCGGGG + Exonic
1053867822 9:42458702-42458724 CGCGCCCGGCCAGGAATCTGAGG - Intergenic
1055973105 9:81930920-81930942 GGAGCCCAGCCTCCAACCTGAGG + Intergenic
1055974858 9:81946012-81946034 GGAGCCCAGCCTCCAACCTGAGG + Intergenic
1061498672 9:130990137-130990159 GGGGACCGGACACCAGCCTGTGG + Intergenic
1061601214 9:131671439-131671461 TGGGCCCGCCCACAAAACTGGGG + Intronic
1190245164 X:48686019-48686041 GGGGCTAGCCCAGGAACCTGTGG + Intronic
1199601602 X:149544466-149544488 GGGGCGGGGCCACGGGCCTGAGG + Intronic
1199648775 X:149935017-149935039 GGGGCGGGGCCACGGGCCTGAGG - Intronic