ID: 1165461135

View in Genome Browser
Species Human (GRCh38)
Location 19:35945002-35945024
Sequence GAACCTGTGGGACCCTAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461121_1165461135 18 Left 1165461121 19:35944961-35944983 CCGTGGTCCAGCTGGACTGCGAG 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1165461129_1165461135 -6 Left 1165461129 19:35944985-35945007 CCTGGGGGCCCGGCCACGAACCT 0: 1
1: 0
2: 0
3: 2
4: 139
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1165461119_1165461135 24 Left 1165461119 19:35944955-35944977 CCCACACCGTGGTCCAGCTGGAC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1165461120_1165461135 23 Left 1165461120 19:35944956-35944978 CCACACCGTGGTCCAGCTGGACT 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1165461128_1165461135 -5 Left 1165461128 19:35944984-35945006 CCCTGGGGGCCCGGCCACGAACC 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112
1165461123_1165461135 11 Left 1165461123 19:35944968-35944990 CCAGCTGGACTGCGAGCCCTGGG 0: 1
1: 0
2: 3
3: 40
4: 294
Right 1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461135 Original CRISPR GAACCTGTGGGACCCTAGCC AGG Exonic
900173339 1:1281183-1281205 GCATCTGTGGGACCCCAGCCAGG - Intronic
900946824 1:5835483-5835505 GAACCTCTGGGACCTGACCCAGG + Intergenic
904344510 1:29859297-29859319 GTACCTGTGAGACCCTGCCCAGG + Intergenic
906205860 1:43985963-43985985 GCACCTGTGGGACCCCTGCCGGG + Intronic
906888761 1:49683607-49683629 GAAGCTGTGGGAGAATAGCCTGG + Intronic
907269910 1:53284899-53284921 GTAGCTGTGTGACCCTAGGCAGG - Intronic
912547067 1:110458410-110458432 GACCCTGTGGGGGCCTGGCCTGG - Intergenic
922729663 1:227942969-227942991 GCACCTGTGGGTCCCTGGCAGGG - Intronic
1062911408 10:1214879-1214901 GACCCTGTGGCTCCCCAGCCAGG + Intronic
1063148301 10:3315834-3315856 GTACCTGAAAGACCCTAGCCAGG + Intergenic
1066471177 10:35699726-35699748 GAAACTGGTGGAACCTAGCCGGG + Intergenic
1066998640 10:42585970-42585992 GAACCTGTGGGACCAGAGTCAGG + Intronic
1067936351 10:50615498-50615520 GAAGCTGTGGGACCTTAGGCAGG - Intronic
1075482035 10:122790010-122790032 GAAAATGTGGGGCCCTGGCCAGG - Intergenic
1075726829 10:124614993-124615015 GAAAGTGTGGGACCCACGCCGGG + Intronic
1076244891 10:128939146-128939168 GTCCCTGTGGGACCTTGGCCAGG - Intergenic
1076496683 10:130901957-130901979 GATGCTGTGGTACCATAGCCAGG + Intergenic
1077076600 11:705170-705192 GCCCCTCTGGGACCATAGCCCGG + Intronic
1077216863 11:1398626-1398648 GAACCTCTGGCCCCCTGGCCTGG - Intronic
1079003560 11:16777078-16777100 GCAACTGTGGAAGCCTAGCCAGG + Intergenic
1080456698 11:32426061-32426083 CACCCTGTGGGACCCTAGGAAGG - Intronic
1092289652 12:7151643-7151665 GAACCTTTGGGACCACGGCCAGG - Intronic
1094165026 12:27435027-27435049 GAAGCTGGGGTTCCCTAGCCAGG + Intergenic
1098956591 12:76695232-76695254 GGATCTGTGGTACCTTAGCCAGG - Intergenic
1104013336 12:124947291-124947313 GAGCCTGGGGGCCCCCAGCCAGG + Exonic
1105016109 12:132787590-132787612 GAACCCCTGGGACCCTTCCCCGG + Intronic
1112626806 13:101114179-101114201 TAAGCTGTGGGACCTTAGACAGG + Intronic
1118317467 14:64734006-64734028 ACATCTGTGGGACCCAAGCCAGG - Intronic
1118917990 14:70123937-70123959 GACCCTGGGGGACCGGAGCCTGG - Intronic
1121173896 14:91876184-91876206 GAAGCTGCGGGACCCTCCCCGGG - Intronic
1121495611 14:94389789-94389811 GATCCTGTGGGTCACTCGCCTGG - Intronic
1121954954 14:98205258-98205280 GAACCTAAGGGACCCTAACTGGG + Intergenic
1122415988 14:101549716-101549738 CAGCGTGTGGGACCCTAGCACGG - Intergenic
1122770445 14:104095400-104095422 GCACCCGTGGGACCCTGGCCTGG - Intronic
1124621875 15:31278618-31278640 GAACCAGGGGGACTCTAGCCAGG - Intergenic
1124721788 15:32117045-32117067 GAACCTGGGGGAGCCAACCCAGG + Intronic
1125716127 15:41820972-41820994 AAGCCTGCAGGACCCTAGCCAGG + Exonic
1129756284 15:78101163-78101185 GACTCTGTGGGACCCTGGTCTGG - Exonic
1130989603 15:88868419-88868441 GAACCTCGGGGGCCCCAGCCAGG - Intronic
1137056091 16:35747310-35747332 AAACCTGAGGGCCCCCAGCCTGG + Intergenic
1141919812 16:87128158-87128180 GACCATGTGAGACCCTTGCCCGG + Intronic
1142231081 16:88900605-88900627 GTACCTGGGGGACCCTCCCCAGG - Intronic
1142672676 17:1494392-1494414 GAGCCTCTGGGGCCCTAACCAGG - Intergenic
1143116373 17:4584080-4584102 TCACCTGTGGGACCTTCGCCTGG - Intronic
1143720470 17:8805618-8805640 GAACCTGTGGCACCTTGGCCGGG + Intronic
1143872146 17:9964674-9964696 GATGCTGTGAGAACCTAGCCTGG - Intronic
1146123849 17:30217114-30217136 GAGCCTGTGGGCCCCTGGGCAGG + Intronic
1146743173 17:35304595-35304617 GGATCTGTGGTACCTTAGCCAGG + Intergenic
1147428753 17:40358577-40358599 GAAGCTGTGGGGGCCTAGCCGGG + Intergenic
1147498304 17:40938249-40938271 GAAGCTGGGAGCCCCTAGCCAGG + Intergenic
1148048400 17:44757937-44757959 CAACCTGTGGTCCCCTAGCATGG + Intergenic
1150358427 17:64507254-64507276 GAAGCTGAGAGACCCTATCCAGG - Intronic
1151152752 17:72101880-72101902 GAAGCTGTGAGCCCCTGGCCTGG - Intergenic
1151357949 17:73571510-73571532 GAACATGTGGGAGTCCAGCCCGG + Intronic
1157446061 18:47747747-47747769 GCACCCGTGGGACCCTGTCCTGG + Intergenic
1158082138 18:53605278-53605300 GAACCTTTGGGACCCTGAACTGG + Intergenic
1158416872 18:57256642-57256664 GAAAATGTGGGGCCCTGGCCAGG + Intergenic
1159017857 18:63116413-63116435 TTACCTGTGGGAACCCAGCCTGG + Intergenic
1160505788 18:79426325-79426347 GAACCTGTGTCTCCCTCGCCTGG - Intronic
1161040943 19:2110494-2110516 CAACCCTTGGGACTCTAGCCAGG + Intronic
1161234846 19:3192718-3192740 GCAACTGTGTGACCCTAGGCGGG + Intronic
1161268488 19:3376017-3376039 GACCCTGTGGGACCTCAGCCAGG + Intronic
1162822230 19:13229954-13229976 GAACCTGTGAGACCCCTGCTAGG + Intronic
1164836416 19:31357779-31357801 TAAGCTGTGGGAGCCTAGGCAGG + Intergenic
1165461135 19:35945002-35945024 GAACCTGTGGGACCCTAGCCAGG + Exonic
1165490075 19:36118307-36118329 GAAGCTGGGAGACCCTATCCTGG + Intronic
925778464 2:7357417-7357439 GAACGTGCTGGACCCCAGCCTGG - Intergenic
932333861 2:70918266-70918288 GAACCTGTGAGATCTGAGCCAGG + Intronic
934053045 2:88226218-88226240 GTACCTATGGGACCTTAGACAGG - Intergenic
934841630 2:97627634-97627656 ACACCTGAGGGACCCTGGCCAGG - Intergenic
936525173 2:113236509-113236531 GAAGGTGTGGGGCCCTGGCCTGG - Intronic
948387394 2:237589926-237589948 GATCCTGTGTCACCCTTGCCTGG + Intronic
948592109 2:239057404-239057426 GAAGATGTGAGACCCAAGCCAGG + Intronic
1171397920 20:24850658-24850680 AAACCAGAGGTACCCTAGCCTGG - Intergenic
1173548643 20:43916931-43916953 GAACCTGTGCGAATCTCGCCGGG + Intronic
1175183050 20:57161913-57161935 GAACCTGAGGGACTCTTGGCCGG + Intergenic
1178829070 21:36040086-36040108 GAACATGAGGGAGCCTGGCCAGG + Intronic
1179989476 21:44939783-44939805 GATCGTGGGGGACCCAAGCCCGG - Exonic
1183212134 22:36457702-36457724 CCACCTGTGGGACTCTAGCCAGG + Intergenic
1183499881 22:38172626-38172648 GGACCTGTGGGACTCAGGCCTGG + Intronic
1183641010 22:39092348-39092370 CATCCTGGGGGCCCCTAGCCTGG + Intergenic
1184523603 22:45009256-45009278 GGACGCGTGGGACCCGAGCCTGG - Intronic
1185065164 22:48628399-48628421 GAACCTGCAGGACCCCAGCAGGG - Intronic
950409461 3:12825773-12825795 CGAGCTGTGGGACCCCAGCCAGG + Intronic
951612666 3:24508901-24508923 AAACCTGTCTGACCCTAACCTGG + Intergenic
952367189 3:32685335-32685357 GAACCTGGGGGCCCGGAGCCGGG + Intronic
956846690 3:73190001-73190023 AAACCTGTCAGACCCTGGCCGGG + Intergenic
957475597 3:80719179-80719201 GAACCTTTGGAAGCATAGCCAGG + Intergenic
963110075 3:141681230-141681252 GAAACTGTGGGAACCTGGGCTGG + Intergenic
964743367 3:159989437-159989459 GTAGCTGAGGGACCCTAGGCAGG - Intronic
965096683 3:164237601-164237623 ATACCTGTTTGACCCTAGCCTGG - Intergenic
969622460 4:8285588-8285610 GAACCTTCGGGACCCCAGCGTGG - Intronic
977247330 4:94648593-94648615 GAAACTGTGGGACACTGGCCGGG - Intronic
991509834 5:67364482-67364504 GAACAAGTGGGACCTTTGCCTGG - Intergenic
995461822 5:112411404-112411426 GAACCTGTGCAACCTTAGGCAGG + Intronic
996768826 5:127064096-127064118 AAACAAGTGGGAACCTAGCCTGG + Intronic
1001757353 5:174180808-174180830 GAACCTGGGGTACCCTCCCCTGG - Intronic
1004637610 6:17483906-17483928 GAACCTATGGGGCTCTATCCAGG - Intronic
1010746124 6:79563593-79563615 CAACCTGTGGCAGACTAGCCTGG - Intergenic
1014334003 6:120108343-120108365 GAATGTGTGGGCCCCTATCCTGG - Intergenic
1015753170 6:136581714-136581736 GAACAAGTGGGAACCTAGCAAGG - Intronic
1019556361 7:1633491-1633513 GAACCTGTGGGAGCCTTACCTGG + Intergenic
1019713307 7:2527127-2527149 GAACCTGTGGGAACAGAGCAGGG - Exonic
1020045752 7:5039123-5039145 AAACCTGTGGGTTCCTGGCCGGG + Intronic
1020111537 7:5450795-5450817 GCGCCTGTGGGACCCTCTCCTGG - Intronic
1020291158 7:6723328-6723350 AAACCTGTGGGTTCCTGGCCGGG + Intergenic
1020858617 7:13459722-13459744 GAAGCTGTGGGAGCCAAGGCTGG + Intergenic
1021784295 7:24136809-24136831 GAACATGTAGGAACCCAGCCTGG + Intergenic
1026433767 7:70375060-70375082 GAAACTGTGCGATCCTATCCTGG - Intronic
1026462953 7:70631018-70631040 GAGCCTGTGGGACACCAGCCGGG - Intronic
1029207758 7:98879271-98879293 GAGCCTGGGGGGCCCTGGCCGGG - Intronic
1033587415 7:142784369-142784391 CAAGCTGTGGGTCCCAAGCCTGG + Intergenic
1036405835 8:8454612-8454634 GAACCAGTGGGACTCAAGCTTGG + Intergenic
1046124171 8:109883318-109883340 GAACCTCTGGGACTCTCACCAGG + Intergenic
1048205775 8:132414221-132414243 GAACCTGTGGGACCAGGGGCTGG - Intronic
1056538573 9:87552129-87552151 GAAGCTGTGGGACCCCAGGCAGG - Intronic
1056793285 9:89639886-89639908 GCACCTGTGAGACCCGAGCCTGG + Intergenic
1057863067 9:98657473-98657495 GCCCCTGTGGAACCCTGGCCAGG + Intronic
1058556769 9:106177072-106177094 CAAACAGTGGGAACCTAGCCTGG + Intergenic
1059335625 9:113566837-113566859 GTGCCTGTGGGATCCCAGCCAGG + Intronic
1062011432 9:134269051-134269073 CAAGCTGTGTGACCCTAGGCGGG + Intergenic
1062452582 9:136621769-136621791 GAGCCTGTGGGCCTCCAGCCAGG - Intergenic
1194529043 X:95021439-95021461 GAACCTGGGGAACACTATCCTGG + Intergenic
1197728879 X:129793974-129793996 GAACCTGTAGGGCCCTGGCCTGG - Exonic
1200067720 X:153512170-153512192 GAGCCTGTGGGAGCAGAGCCTGG - Intergenic
1201749980 Y:17421754-17421776 GGATCTGTGGTACCTTAGCCAGG - Intergenic
1202232757 Y:22672359-22672381 GACCCTGTGTGCCCCTGGCCTGG + Intergenic
1202310399 Y:23523799-23523821 GACCCTGTGTGCCCCTGGCCTGG - Intergenic
1202560403 Y:26146795-26146817 GACCCTGTGTGCCCCTGGCCTGG + Intergenic