ID: 1165461159

View in Genome Browser
Species Human (GRCh38)
Location 19:35945068-35945090
Sequence CCAGGTCCCACAGGGTGTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165461159_1165461172 27 Left 1165461159 19:35945068-35945090 CCCGGACACCCTGTGGGACCTGG 0: 1
1: 0
2: 0
3: 43
4: 348
Right 1165461172 19:35945118-35945140 TTTTAAAACTCTGATGGGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 419
1165461159_1165461170 23 Left 1165461159 19:35945068-35945090 CCCGGACACCCTGTGGGACCTGG 0: 1
1: 0
2: 0
3: 43
4: 348
Right 1165461170 19:35945114-35945136 TGGTTTTTAAAACTCTGATGGGG 0: 1
1: 0
2: 3
3: 40
4: 325
1165461159_1165461169 22 Left 1165461159 19:35945068-35945090 CCCGGACACCCTGTGGGACCTGG 0: 1
1: 0
2: 0
3: 43
4: 348
Right 1165461169 19:35945113-35945135 ATGGTTTTTAAAACTCTGATGGG 0: 1
1: 0
2: 3
3: 30
4: 316
1165461159_1165461171 26 Left 1165461159 19:35945068-35945090 CCCGGACACCCTGTGGGACCTGG 0: 1
1: 0
2: 0
3: 43
4: 348
Right 1165461171 19:35945117-35945139 TTTTTAAAACTCTGATGGGGAGG 0: 1
1: 0
2: 4
3: 28
4: 310
1165461159_1165461168 21 Left 1165461159 19:35945068-35945090 CCCGGACACCCTGTGGGACCTGG 0: 1
1: 0
2: 0
3: 43
4: 348
Right 1165461168 19:35945112-35945134 CATGGTTTTTAAAACTCTGATGG 0: 1
1: 0
2: 2
3: 22
4: 351
1165461159_1165461166 3 Left 1165461159 19:35945068-35945090 CCCGGACACCCTGTGGGACCTGG 0: 1
1: 0
2: 0
3: 43
4: 348
Right 1165461166 19:35945094-35945116 CAAACTCACCAAATCGCTCATGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165461159 Original CRISPR CCAGGTCCCACAGGGTGTCC GGG (reversed) Exonic
901925636 1:12564510-12564532 CCTGGTTCCACAGGCTGTACAGG - Intergenic
902189996 1:14755692-14755714 CCTGGGCACAGAGGGTGTCCAGG - Intronic
902411210 1:16212546-16212568 CCAGAGCCCCCAGGGTGTCCCGG - Exonic
902512619 1:16974659-16974681 CCAGGTCCCACAGAGAGGCCTGG + Exonic
902600992 1:17540036-17540058 CCAGGGTCCTCCGGGTGTCCTGG + Intronic
902983609 1:20142315-20142337 CCAGGTCCCACAGGCTGGAGGGG - Intronic
903060719 1:20666635-20666657 CCAGCTCCAACAGGGGGGCCGGG + Intronic
903351517 1:22719639-22719661 CCAGGTCACACAGGGTAACAGGG - Intronic
904391530 1:30189278-30189300 GCAGGTGCCCCAGGGTGTCCAGG - Intergenic
904437921 1:30511322-30511344 CAAGATTCCACAGGCTGTCCGGG - Intergenic
905370767 1:37481602-37481624 CCAGTTCCCGCAGGATGTGCTGG - Exonic
905375102 1:37514689-37514711 CCAGCTCCCGCCGGGTGTCCGGG + Exonic
905762881 1:40575087-40575109 TCAGGTTCCACAGGCTGTACAGG - Intergenic
906048319 1:42850322-42850344 CCAGGCCCCACAGTAGGTCCTGG + Intronic
906665500 1:47618544-47618566 CCAGACCCCACAGGCTTTCCAGG - Intergenic
906684824 1:47756543-47756565 CCCCGTCCCAGAGGTTGTCCCGG - Intergenic
906685545 1:47761014-47761036 CCAGGACCCACAGGCTGCCATGG - Exonic
908655146 1:66380591-66380613 CCAGGTCCCACAGGACCTGCTGG + Intergenic
908682873 1:66682117-66682139 CCAGGTCCCACAGGCCCCCCAGG + Exonic
911008428 1:93252973-93252995 CCAGGTCCAGAAGGCTGTCCTGG + Intronic
911862465 1:102970226-102970248 CCACGTTGCCCAGGGTGTCCTGG + Exonic
913431147 1:118792098-118792120 CTAGGTTCCACAGGGTGGCCTGG - Intergenic
914052529 1:144147090-144147112 CCAGGTCCAACACAGTGCCCAGG + Intergenic
914126668 1:144819451-144819473 CCAGGTCCAACACAGTGCCCAGG - Intergenic
915941565 1:160121498-160121520 CCAGGCCCCAGAGGGCCTCCAGG + Intronic
916000029 1:160606523-160606545 CCTGGTCCCCCAGGAAGTCCAGG - Intergenic
916513881 1:165497607-165497629 CCAGGCCCCACAGTGTGCCCAGG - Intergenic
918041527 1:180916755-180916777 CCAGGACCCCCAGGCCGTCCGGG - Exonic
919809002 1:201397430-201397452 CAAGTTCCCACAAGATGTCCAGG - Intronic
920433363 1:205932936-205932958 CCAGGTCCCACAAGGTGAAGGGG - Exonic
921998980 1:221454699-221454721 CCAGATGACACAGGGTTTCCTGG - Intergenic
922409994 1:225363648-225363670 CCAGTATCCACAGGGGGTCCTGG - Intronic
922785020 1:228278389-228278411 CCAGGTCCTACCCGCTGTCCCGG - Intronic
922786985 1:228287710-228287732 CCAGGTCCTTCAGGGCCTCCTGG - Exonic
924600347 1:245483118-245483140 CCAGATCTCACAGGGTTTCATGG + Intronic
924744361 1:246818419-246818441 CCAGGTCCCACAGAGAGGCCTGG - Intergenic
924775413 1:247112159-247112181 CCAGGTCCCGCAGGATGTGGAGG + Exonic
1062786821 10:271745-271767 CCAGGTCCAAGTGGATGTCCAGG - Intergenic
1063829076 10:9931588-9931610 CCAGGACCCCCAGGCTCTCCAGG - Intergenic
1064702645 10:18037687-18037709 CCAGGTCTTTCAGGTTGTCCTGG - Intronic
1064819497 10:19309988-19310010 CCAGCTCCCACAGTGAGTCAGGG + Intronic
1066759448 10:38738846-38738868 CCAGGTCCAACACAGTGCCCAGG - Intergenic
1066962171 10:42233915-42233937 CCAGGTCCAACACAGTGCCCAGG + Intergenic
1067556994 10:47279456-47279478 CCAGGTCCCACGGGGTGCTGTGG + Intergenic
1070459330 10:76648950-76648972 CACGGTCCCACAGGCTGTACAGG - Intergenic
1070647915 10:78214297-78214319 CCAGGTCCCTCTGCCTGTCCTGG + Intergenic
1070832227 10:79425075-79425097 CCAGGACACACAGTCTGTCCAGG - Intronic
1075724834 10:124605905-124605927 CCGGAACCCACAGGGTGACCCGG - Intronic
1075734379 10:124654982-124655004 ACAGGTCCCAAAGCGTGCCCAGG + Intronic
1076106318 10:127826544-127826566 GCAGGTCCCAGAGGGAGGCCTGG + Intergenic
1076765562 10:132631121-132631143 CCAGATCACACAGGCTGGCCAGG + Intronic
1076814651 10:132908822-132908844 CCACACCCCACAGGGTGTCCTGG + Intronic
1077361540 11:2142852-2142874 CCAAATCACACAGGGTCTCCCGG - Intronic
1078487331 11:11735787-11735809 CCTGATCCTACAGGGTGTCTGGG + Intergenic
1078857890 11:15221329-15221351 CCTGGTTCCACATGGGGTCCTGG + Intronic
1079890919 11:26052017-26052039 CATGGTCCCACAGGCTGTACAGG + Intergenic
1081090106 11:38853863-38853885 CCTGGTTCCACAGGCTGTACAGG - Intergenic
1081484205 11:43515462-43515484 TCAGGGCCCCAAGGGTGTCCTGG - Intergenic
1081644065 11:44777787-44777809 CCAGCTCCAGGAGGGTGTCCGGG + Intronic
1083310815 11:61782796-61782818 CCTGACCACACAGGGTGTCCTGG + Intronic
1083655302 11:64226446-64226468 CCGAGTCCCGCAGGGTATCCAGG - Intronic
1083882545 11:65555626-65555648 CTGGGTCCCACAGGGGGTTCGGG + Intronic
1084032637 11:66489911-66489933 CCAGGTCACACAAGGTGAGCAGG - Intronic
1084216535 11:67649982-67650004 CCAGGTCACACAGCCTGTCAGGG - Intronic
1084402793 11:68955075-68955097 CCTGGTCCCACCTGGTGCCCCGG + Intergenic
1089699560 11:120236279-120236301 CCAGGTCCTCCGGGGTCTCCTGG - Intergenic
1090261324 11:125322716-125322738 CCAGATCCCCCAGAGTGTGCAGG + Intronic
1091239406 11:134042566-134042588 CCAGGAACCACAGGGCCTCCCGG - Intergenic
1094160101 12:27381361-27381383 CCCGGTTCCACAGGCTGTGCAGG + Intronic
1095369624 12:41451751-41451773 CCAGGTCCCCTCTGGTGTCCTGG + Intronic
1096215016 12:49793782-49793804 CCGGGGCCCACAGGCTGGCCAGG + Exonic
1096235717 12:49924937-49924959 CCAGGTAGGACAGGGTGTTCAGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1101088198 12:101257602-101257624 CCAGGTCCCAGAGGGTCACTTGG - Intergenic
1101368325 12:104099040-104099062 CAAGGTTCCACAGGCTGTACAGG + Intronic
1101600551 12:106205852-106205874 CCAGCTCCCACAGGGTCTTGAGG - Intergenic
1102031351 12:109741762-109741784 CGGGGTCACACAGGGTGTGCTGG + Intronic
1103070456 12:117936946-117936968 CCAGAGCCCAGAGGGTGCCCAGG + Intronic
1103174315 12:118848774-118848796 CCTGGTCCCACAGGGAGCTCTGG + Intergenic
1103714444 12:122935808-122935830 CCAGGTCACACAGACTGCCCTGG + Intronic
1103742401 12:123099682-123099704 CCAGGTCCCACTGTGTGCCTGGG + Intronic
1103942152 12:124506939-124506961 CCAGGTCCCACCGCCTCTCCAGG - Intronic
1103970840 12:124670459-124670481 CCATGGCCCACAGGATGTCCAGG - Intergenic
1104035680 12:125095643-125095665 GCAGGTCCCACAGGGTAGGCGGG - Intronic
1104852243 12:131882576-131882598 CCAGGTGCCACAGGGAGCCTCGG + Intergenic
1104927532 12:132321520-132321542 CCGGGGCCAACAGGCTGTCCTGG + Intronic
1105405295 13:20128077-20128099 CCAGCTCCCTCGGCGTGTCCGGG + Intergenic
1106595056 13:31128542-31128564 AAAGAACCCACAGGGTGTCCTGG - Intergenic
1108399129 13:50021503-50021525 CGAGGTCTCACATGTTGTCCAGG + Intergenic
1113398823 13:109973236-109973258 CACTTTCCCACAGGGTGTCCAGG - Intergenic
1113419829 13:110162424-110162446 CCAGGTCCAAGAGGATTTCCAGG - Exonic
1113523032 13:110953998-110954020 CCATGTCCCTGAGGTTGTCCTGG - Intergenic
1113547983 13:111169310-111169332 CATGGTTCCACAGGGTGTACAGG + Intronic
1113702337 13:112396811-112396833 CCATGTCCCTGAGGTTGTCCTGG + Intronic
1113811896 13:113147715-113147737 CCTTCTCCCACTGGGTGTCCAGG + Intronic
1119473086 14:74911351-74911373 CCAGGTGCCACATGGTGAGCAGG - Exonic
1119872350 14:78028437-78028459 CCAGGTCCAACAGGGTGTGGTGG - Intergenic
1120345905 14:83289904-83289926 CCAGGTTCCACAGGATTTCAGGG + Intergenic
1121291223 14:92777190-92777212 CCTGATCCCACAGGGAGTTCTGG - Intergenic
1122452274 14:101819278-101819300 CCAGGGGCCACAGGCTGCCCAGG - Intronic
1122656767 14:103267371-103267393 CACGTTCCCACAGGCTGTCCAGG + Intergenic
1123422196 15:20143067-20143089 CCAGGTCCAACACAGTGCCCAGG + Intergenic
1123442878 15:20303550-20303572 CCAGGTCCAACAGAGTGGCCAGG - Intergenic
1123531424 15:21149607-21149629 CCAGGTCCAACACAGTGCCCAGG + Intergenic
1124925245 15:34064133-34064155 CCAAGTGCCACAGGGTGACTGGG - Exonic
1125841185 15:42802386-42802408 CCATGTCCATCAGGGTGACCCGG - Intronic
1126627522 15:50699244-50699266 CGAGGTCCCACATGTTGCCCAGG + Intergenic
1126978260 15:54210823-54210845 CCAGTTCCCACAGGATGACTTGG + Intronic
1128596203 15:68952394-68952416 CCCGGTTCCACAGGCTGTACAGG - Intronic
1130147734 15:81287328-81287350 GGAGGTACCACGGGGTGTCCAGG + Intronic
1131812247 15:96184663-96184685 CCAGGTTCCTCAGGGTGCCTGGG - Intergenic
1132602354 16:779367-779389 CCTGGCCCCACAGGGTGTTCTGG - Intronic
1134442428 16:14307250-14307272 CCAGAGCCCACAGGGTCACCAGG - Intergenic
1135664228 16:24322346-24322368 GCAGGTCCCCAAGGGTGGCCGGG - Intronic
1136276705 16:29183080-29183102 CAAGGTCACACAAGGTCTCCTGG + Intergenic
1136773597 16:32860014-32860036 CCAGGTCCAACACAGTGCCCAGG - Intergenic
1136836735 16:33508401-33508423 CCAGGTCCAACACAGTGCCCAGG + Intergenic
1136862645 16:33712608-33712630 CCAGGTCCAACACAGTGCCCAGG - Intergenic
1136897015 16:34001505-34001527 CCAGGTCCAACACAGTGCCCAGG + Intergenic
1137057342 16:35752027-35752049 CCAGGTCGCAGTGGGTGTGCAGG - Intergenic
1137698857 16:50481263-50481285 CAAGGTCACACAGAGTGTCAGGG + Intergenic
1137815215 16:51392137-51392159 CCACGGCCCACAGGATTTCCAGG + Intergenic
1138458091 16:57132763-57132785 CCAGGCCCCACTGTGTGACCTGG + Intronic
1138458090 16:57132763-57132785 CCAGGTCACACAGTGGGGCCTGG - Intronic
1139005370 16:62563839-62563861 CCCTGAGCCACAGGGTGTCCTGG + Intergenic
1139294051 16:65884617-65884639 CCTGGTCCTGCAGGGTGCCCTGG + Intergenic
1139956001 16:70693281-70693303 CCAGGCCCCACAGCGTGTCTCGG - Intronic
1141180890 16:81752741-81752763 CCAGGGCCCTCAGGGTGCCCAGG + Intronic
1141340083 16:83195366-83195388 CATGGTTCCACAGGCTGTCCAGG + Intronic
1141490609 16:84370110-84370132 TCAGGTTTCACAGGATGTCCAGG + Intronic
1141502631 16:84454461-84454483 CCAGGTACCCCATGGTTTCCAGG + Intronic
1141659035 16:85431733-85431755 CCAGGGCCCAGAGGGTATCTGGG + Intergenic
1142034816 16:87856412-87856434 CCTGGTCCCCCAGGGTGCACCGG + Intronic
1142081087 16:88149141-88149163 CAAGGTCACACAAGGTCTCCTGG + Intergenic
1142398188 16:89844954-89844976 ACAGGTCCCACAGTCTGTCCCGG - Intronic
1203076013 16_KI270728v1_random:1122125-1122147 CCAGGTCCAACACAGTGCCCAGG - Intergenic
1203146915 16_KI270728v1_random:1808680-1808702 CCAGGTCCAACACAGTGCCCAGG + Intergenic
1143326682 17:6103572-6103594 CCACATCCCACAGGGTCCCCTGG + Intronic
1143503827 17:7353149-7353171 CCAGTTCCCGCAGCGCGTCCAGG - Exonic
1144576266 17:16431780-16431802 GCAGGTCCCGCAGGATGACCTGG - Exonic
1144761541 17:17710300-17710322 TCAGCTCCCACAAGGGGTCCTGG - Intronic
1144929620 17:18848745-18848767 CCACCTCCCACAGGCTTTCCCGG - Intronic
1144942618 17:18952132-18952154 CCAGGTCAGAAAGGGTTTCCTGG - Intronic
1146054817 17:29575774-29575796 CCAGTGCCCACAGGGTGGCTGGG - Intronic
1146944356 17:36863880-36863902 GCGGGTCCCACACGGTGTCGTGG - Intergenic
1147570666 17:41568543-41568565 CCAGCTCCGGCACGGTGTCCAGG - Exonic
1148867301 17:50635161-50635183 CCGGGTCCCACGCGGTGTCGGGG + Intronic
1149243098 17:54673720-54673742 CCAGATCCAGCAGGGTGTCCAGG - Intergenic
1150823036 17:68450984-68451006 CCAGGTTCCAAAGGTTCTCCGGG + Intronic
1151700775 17:75741407-75741429 CCAGGTCCTACATCGAGTCCTGG + Intronic
1152201962 17:78952486-78952508 CCAGGTCCCCCTGACTGTCCAGG + Intergenic
1152206249 17:78976216-78976238 CCAGGCCCCATATGCTGTCCTGG + Intronic
1152229614 17:79107898-79107920 CCAGCTCCCGCGGGGTGCCCTGG + Intronic
1152230189 17:79110449-79110471 CCGGGTCCCACCTGCTGTCCAGG - Intronic
1152290543 17:79437527-79437549 CCAGCTCCTACCGGGTGTCCCGG - Intronic
1152312375 17:79559020-79559042 CCAGGGCTCCCAGGGTCTCCTGG - Intergenic
1152387061 17:79980941-79980963 CCAGTTCCCTCAGGGCCTCCCGG - Intronic
1152687252 17:81700706-81700728 CCAGGCCCCACAGAGCCTCCCGG + Exonic
1152785751 17:82247086-82247108 GAAGGCCCCCCAGGGTGTCCAGG + Intronic
1152919850 17:83060768-83060790 CCGGGTCCCACAGGCTGTACAGG - Intergenic
1153650701 18:7237467-7237489 CCAGGACACACAGTGTCTCCAGG - Intergenic
1153884358 18:9450125-9450147 CCAGTTTCCACAGGGTGACATGG - Intergenic
1153982437 18:10321772-10321794 CCAGGACTCAGAGGTTGTCCCGG + Intergenic
1156043227 18:32847806-32847828 GCAGGTCTCACATGGTGTCACGG - Intergenic
1160018855 18:75165066-75165088 CCAGCTCCTACAGGGTACCCTGG - Intergenic
1160215043 18:76921269-76921291 CCAGGTCCCACTGGGTGGTGTGG + Intronic
1160808951 19:1004716-1004738 CCCGCCCCCACAGGGTGCCCAGG + Exonic
1160908772 19:1465278-1465300 CCAGGTCCCACAGCAGCTCCTGG - Exonic
1161268486 19:3376011-3376033 TGAGGTCCCACAGGGTCTCAGGG - Intronic
1161801038 19:6416851-6416873 CCAGGTCCTCCAGGGGGTCCAGG - Exonic
1162359046 19:10206601-10206623 CCAAGTCCCATAGCGTGTGCTGG + Intronic
1162421243 19:10567279-10567301 CTAGGACCTTCAGGGTGTCCAGG + Exonic
1162791637 19:13066063-13066085 TCAGGCCCCACACGGTGTCGAGG - Intronic
1163054653 19:14709200-14709222 CCTGGTTCCACAGGTTGTACAGG - Intronic
1163159507 19:15456493-15456515 CCAGCTCACCCAGGGTCTCCTGG + Exonic
1163322264 19:16581711-16581733 CCAGCTCCCACACAGTTTCCAGG - Intronic
1164401599 19:27905722-27905744 CAAGTTCCCACAGGATGTCCAGG - Intergenic
1164896982 19:31885547-31885569 CCAGGTAGCACAGGTAGTCCAGG - Intergenic
1165070273 19:33251501-33251523 CCAGGCCCCACACGGTGTGGGGG - Intergenic
1165091844 19:33391883-33391905 CCAGAGCCCACAGAGTCTCCTGG - Intronic
1165461159 19:35945068-35945090 CCAGGTCCCACAGGGTGTCCGGG - Exonic
1166974919 19:46600480-46600502 CCCGTTCCCACAGGCTGTCCTGG + Intronic
1167259973 19:48452812-48452834 CCAGGTCCCACTGTGTGATCTGG - Exonic
1167438183 19:49491905-49491927 CCAGGTGCCACAGGCAGCCCTGG + Exonic
1167446217 19:49539115-49539137 CCAGGTCCTCCAGGGTTTCCTGG - Exonic
1202691927 1_KI270712v1_random:99514-99536 CCAGGTCCAACACAGTGCCCAGG + Intergenic
925357643 2:3253376-3253398 CCACGGCCCTCAGGGGGTCCTGG - Intronic
926013713 2:9429222-9429244 CCAGGTCCCACTGGGGCTGCCGG + Intronic
927277728 2:21275744-21275766 CCAGTGCCCAGAGGGAGTCCTGG + Intergenic
927289580 2:21392709-21392731 CCATGTCCCCCAGGCTGCCCAGG + Intergenic
929555286 2:42922010-42922032 CCATGGCCCACTGGGAGTCCTGG - Intergenic
930018073 2:46984451-46984473 CCATGTCCCAGAGGGTGTGAGGG + Intronic
930158539 2:48129609-48129631 GCAGGCCTCACAGGGAGTCCAGG + Intergenic
932274721 2:70443279-70443301 CCAGGGCCCAGAGGGTCTCCTGG - Intergenic
932471389 2:71961827-71961849 CCAGGTCACACAGGGCCTGCTGG - Intergenic
933954465 2:87354442-87354464 CCAGGTCCAACACAGTGCCCAGG - Intergenic
934238659 2:90250662-90250684 CCAGGTCCAACACAGTGCCCAGG - Intergenic
934274535 2:91566048-91566070 CCAGGTCCAACACAGTGCCCAGG + Intergenic
934322769 2:91983197-91983219 CCAGGTCCAACACAGTGCCCAGG - Intergenic
934461078 2:94213993-94214015 CCAGGTCCAACACAGTGCCCAGG - Intergenic
935140634 2:100350098-100350120 CAAGGTTCCACAGGCTGTACAGG - Intergenic
935209312 2:100924719-100924741 CCAGGGCCCACGGGGTGGCCAGG - Intronic
936663803 2:114571422-114571444 CACGGTTCCACAGGCTGTCCAGG - Intronic
936941651 2:117890286-117890308 CCAGGTCCCACAGGATGGGATGG - Intergenic
937503892 2:122514512-122514534 CCAAGTTCCCTAGGGTGTCCTGG + Intergenic
938114599 2:128594722-128594744 CCAAGTCCCACAGGGACTCCGGG + Intergenic
938137263 2:128769741-128769763 GCAGGTCTCACAGGGTGACTGGG + Intergenic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
945897844 2:215504621-215504643 CCAGGTCCCACTGGCTATTCTGG - Intergenic
946367068 2:219254711-219254733 CAAGGTCACACAGGGTAGCCTGG - Intronic
947150370 2:227109240-227109262 GCAGGTCCCACAGGATATCCTGG - Exonic
947613660 2:231540160-231540182 TCAGGCCACACAGGCTGTCCTGG + Intergenic
947615972 2:231557198-231557220 CCAGGTCCTTCATGGTCTCCCGG + Intergenic
948911758 2:241008451-241008473 CTAGGCCAGACAGGGTGTCCTGG + Intronic
1168788870 20:562734-562756 GGAGTCCCCACAGGGTGTCCAGG + Intergenic
1169671288 20:8105847-8105869 CCAGGTCACCAAGGGGGTCCTGG - Intergenic
1169745541 20:8939016-8939038 CATGGTCCCACAGGCTGTACAGG + Intronic
1170057003 20:12216697-12216719 CTAGGTCCCACAGGGTGCTCTGG - Intergenic
1170475424 20:16709508-16709530 CCAGTCCCCACATGGAGTCCAGG - Intergenic
1170571805 20:17636914-17636936 CCAGGGCCAGCAGGGTTTCCAGG - Intronic
1172845443 20:37927546-37927568 CCAGGGCCCAGAAGGTGTCTGGG + Intronic
1173405399 20:42760013-42760035 CCTGGTCCCACAAGGAGTCATGG + Intronic
1173858605 20:46267674-46267696 CAAGGTCACACATGGTGTCAGGG - Intronic
1174363077 20:50040470-50040492 CCAGGTCCCCGAGCCTGTCCTGG + Intergenic
1175191713 20:57216193-57216215 CCAGGTCCCAGAAGCTGTGCCGG + Intronic
1175880870 20:62258101-62258123 CTAGGAGCCACAGGGTGTGCGGG + Intronic
1175999166 20:62824463-62824485 CCAGGTCCCCCAGGGCCCCCTGG + Exonic
1176221920 20:63973799-63973821 CCAGCTCCCTCAGGGCCTCCTGG - Intronic
1176232413 20:64039089-64039111 CCAGGTGCCACAGGAAGTGCGGG - Intronic
1177770835 21:25513831-25513853 CCTGGTTCCACAGGCTGTACAGG + Intergenic
1178368858 21:32010456-32010478 CGTGGTTCCACAGGCTGTCCAGG + Intronic
1179041814 21:37809851-37809873 ACAGGTCCCCCAGAGTGACCTGG + Intronic
1179727329 21:43347728-43347750 CCTCTTCCCACCGGGTGTCCTGG - Intergenic
1179801796 21:43814699-43814721 CCTGGTCCCACTGGGAGCCCTGG + Intergenic
1180052112 21:45335942-45335964 CTAGGTGCCACAGGGTGCCGGGG + Intergenic
1180549530 22:16529101-16529123 CCAGGTCCAACACAGTGCCCAGG - Intergenic
1181355165 22:22292733-22292755 CCAGGTCCAACACAGTGCCCAGG + Intergenic
1181522709 22:23458753-23458775 CCAGGAGCCACAGGGCGGCCTGG - Intergenic
1181751867 22:24994561-24994583 CCAGGCACCACAGGGTGCCTGGG - Intronic
1182228505 22:28818679-28818701 ACAGGTCCCACAAGCTCTCCTGG + Intergenic
1182284055 22:29233610-29233632 CCAGGTCCCCCTGGGCCTCCTGG + Exonic
1182422263 22:30254318-30254340 CCAGGTCACACAGTGTGTAATGG + Intergenic
1182695940 22:32199412-32199434 CCAAGTCCCACTGTCTGTCCAGG - Intronic
1182913671 22:34008443-34008465 CTATGTCTGACAGGGTGTCCAGG - Intergenic
1183032411 22:35116050-35116072 CCAGGTACAGCAGGGTGTCCAGG + Intergenic
1183498314 22:38163096-38163118 CCAGGGACCTCAGGGGGTCCTGG + Intronic
1183508666 22:38222816-38222838 CCAGGCCCCACAGGGCACCCAGG + Intronic
1183670253 22:39268700-39268722 CCAGGTCCCAGAGGGCCCCCAGG + Intergenic
1183930219 22:41231770-41231792 TCAGGACCCACAGGGGCTCCTGG + Intronic
1184257894 22:43297356-43297378 CTTGGTCCCACAGGGTCTCTGGG + Intronic
1184609545 22:45594002-45594024 CCAGGTGACATAGGGGGTCCAGG + Intronic
1184667448 22:45996465-45996487 CCAGGACCTCCAGGGTGCCCCGG + Intergenic
1185179453 22:49350649-49350671 GCAGGTGCCGCAGGGTGCCCTGG - Intergenic
950666941 3:14503419-14503441 CCTTTTCCCACAGGGTGCCCAGG + Intronic
951823260 3:26837862-26837884 CCAGGTCCCACAAGATCTACTGG - Intergenic
952082083 3:29771699-29771721 CCTGGTTCCACAGGGTGTATAGG + Intronic
952334389 3:32392090-32392112 CGAGGTTCTACAGGGCGTCCCGG + Intronic
952925569 3:38316987-38317009 CCAGTTCCCAAATGGGGTCCTGG - Intronic
952958831 3:38577101-38577123 CCATGTCCCACTGTGTGTCCAGG - Intronic
953236413 3:41111373-41111395 CCTGGTCCTACAGGGTGCTCTGG - Intergenic
953891688 3:46755991-46756013 CCAGGTCCCACAGCCTGATCAGG + Intronic
953897168 3:46811666-46811688 CCAGGTCCCACAGCCTGATCAGG + Intronic
956702917 3:71974349-71974371 CATGGTCCCACAGGGCGTCTAGG - Intergenic
957946319 3:87067979-87068001 CTAAGTCCCACTGTGTGTCCTGG + Intergenic
960108169 3:113820060-113820082 CCTGGTCCCACAGGGAGCGCTGG - Intergenic
961408919 3:126704378-126704400 CCGGGTGCTGCAGGGTGTCCGGG + Exonic
961483365 3:127197862-127197884 GCAGGCCCCACAGGGTGGCCAGG - Exonic
961555118 3:127691873-127691895 CCAGCTCCCACAAGGGTTCCAGG - Exonic
961673596 3:128551577-128551599 ACAGCTCCCACAGGCTGTCCTGG - Intergenic
961920693 3:130422735-130422757 CCAGGTCCCCCAGGAATTCCAGG - Exonic
966933424 3:184690538-184690560 CCAGGTGACAGAGGGTGTCAAGG - Intergenic
967150171 3:186641017-186641039 CCCCTTCCCACAGGGTGGCCTGG + Exonic
967636255 3:191805681-191805703 CCTGGTTCCACAGGCTGTACAGG + Intergenic
967871289 3:194231965-194231987 CAAGGCCCTAGAGGGTGTCCCGG + Intergenic
967969226 3:194986855-194986877 CCAGGCCCGACTGGGTGTCTAGG - Intergenic
968359398 3:198136825-198136847 ACAGGCCCCCCAGGGTGCCCAGG + Intergenic
968437812 4:603241-603263 CCAGGTCACACAGAGTCCCCTGG - Intergenic
968502679 4:958388-958410 GCAGGACCCGCAGGGTGGCCAGG - Exonic
968713431 4:2137542-2137564 CCAGACCCCACATGGTGTCAGGG - Intronic
968805530 4:2769201-2769223 CAGGGTGTCACAGGGTGTCCAGG + Intergenic
969258213 4:6017319-6017341 CCAGCTCCCGCTGGGTGGCCTGG - Intergenic
969294727 4:6263144-6263166 ACAGGTCTCACTGGGTGCCCTGG - Intergenic
969866412 4:10079479-10079501 CCAGTTCCCACAGGCTGAGCCGG + Intronic
970044870 4:11840682-11840704 CATGGTTCCACAGGGTGTTCAGG - Intergenic
970620171 4:17810363-17810385 CGAGGTTCCACAGGGCGTGCAGG - Intronic
973158484 4:46987928-46987950 CCAGGTCTCATAGGGTCTCTGGG - Intronic
973544011 4:51962079-51962101 GCAGGTCACACAGGGTGTTGTGG + Intergenic
974652857 4:64777573-64777595 CCAGGTGACTCAGGGTTTCCTGG + Intergenic
977984108 4:103361313-103361335 CATGGTCCCACAGGCTGTACTGG - Intergenic
978834506 4:113132678-113132700 CTGGGTCCTACAGGGTATCCAGG + Intronic
980457518 4:133065196-133065218 CCAGGTTCCAAAGGCTGTACGGG + Intergenic
982201828 4:152968954-152968976 GCAGGGCCCACAGGGTGTGTCGG + Intronic
982231309 4:153210745-153210767 CCAGAACACACAGAGTGTCCAGG - Intronic
985569884 5:639148-639170 CCAGGTCCAAGAGCGTCTCCAGG - Exonic
986104661 5:4648491-4648513 TCAGGTCCCACAGGCTTTCAAGG - Intergenic
987579824 5:19775365-19775387 CCTGGTTCCACAGGCTGTACAGG + Intronic
991269928 5:64768078-64768100 CTAGGACCCACCGGGTGTGCGGG - Intronic
991669365 5:69032395-69032417 CCTGATCCCACAGGGAGTTCTGG - Intergenic
995223884 5:109682435-109682457 CCAGATCCCACAGGGTCTGAGGG + Intergenic
997262645 5:132476433-132476455 CCAGTCCCCACAGGGTCTGCGGG - Intergenic
997639259 5:135437857-135437879 ACAGGTCTTACAGGGTGTCTGGG - Intergenic
999382924 5:151134426-151134448 CCTGGTACAACAGGATGTCCAGG - Exonic
999623541 5:153496536-153496558 CCAGATCCCAAAGGGGGTACTGG + Intronic
1000016460 5:157282157-157282179 CAAGGTTCCACAGGCTGTACAGG + Intronic
1001416189 5:171546064-171546086 CCAGGCTCCCCAGGGTGGCCCGG - Intergenic
1002088434 5:176790615-176790637 CCAGCTCAGACTGGGTGTCCAGG + Intergenic
1002270848 5:178070959-178070981 CCAGGGCCCCCAGGGTCTGCAGG - Intergenic
1002299959 5:178252436-178252458 CCACTTCCCTCCGGGTGTCCTGG - Intronic
1002441720 5:179267727-179267749 ACAGCTCCCACTGGGTGTGCAGG + Intronic
1002457620 5:179354594-179354616 CCAGAGCCCACACGGTGCCCCGG + Intergenic
1002591436 5:180293452-180293474 CCAGGATCCACAGAGTGGCCAGG + Intergenic
1003608365 6:7585778-7585800 CCGGGTCCCGCAGTGGGTCCCGG + Exonic
1004277500 6:14251549-14251571 CATGGTTCCACAGGCTGTCCAGG + Intergenic
1006458817 6:34146269-34146291 CCAGATCTCACAGCCTGTCCAGG + Intronic
1006519121 6:34561400-34561422 CCAGCTGCAACATGGTGTCCTGG - Intergenic
1006671689 6:35733307-35733329 CCACGCCCCACATGTTGTCCAGG + Intergenic
1007370970 6:41427031-41427053 CAAGGTCCCACGGCGAGTCCAGG + Intergenic
1007417159 6:41698410-41698432 CCAGGAGCCAGAGGGTGTCCGGG + Intronic
1008007326 6:46424693-46424715 CCAGGTCACACAGTCTGTCAGGG - Intronic
1009939127 6:70268820-70268842 CCAGGTCGCTCAGGATATCCAGG - Exonic
1010796149 6:80119096-80119118 CCAGGTCTCACATGCTGCCCAGG - Intronic
1011543281 6:88456746-88456768 CCAGGTACCACATTGAGTCCTGG + Intergenic
1016792101 6:148076804-148076826 CCAGGTCCCACACCTTTTCCAGG - Intergenic
1017983958 6:159426289-159426311 GCAGGACCCACAGGGTCTCCAGG + Intergenic
1018152773 6:160955848-160955870 CCTGTGGCCACAGGGTGTCCTGG + Intergenic
1018669472 6:166167320-166167342 CCAGGTCCCCCAGGCTGCCCAGG + Intronic
1018912208 6:168108314-168108336 CCATGTCCCACAGAGTGAACTGG - Intergenic
1019132084 6:169884362-169884384 CCAGGTGCTTCAGGGTCTCCCGG - Intergenic
1019328939 7:453231-453253 CCGGCTCCCACAGTGTCTCCAGG - Intergenic
1019588616 7:1817784-1817806 CCAGGAGCCACAGGGCGGCCTGG + Intronic
1020519659 7:9169652-9169674 CCAGGACGCACAGGGGGTCGGGG - Intergenic
1021375287 7:19899567-19899589 CCAGTTCCCACAGTGTGTAAAGG - Intergenic
1024672623 7:51609830-51609852 TCAGTACCCACAGGGTGTCCTGG - Intergenic
1024919756 7:54544874-54544896 GCAGGTCCCCAGGGGTGTCCAGG - Intronic
1025225009 7:57150549-57150571 CCCCGCCCCACAGGGTGGCCTGG - Intergenic
1029277953 7:99418697-99418719 CCAGATTCCACAAGGAGTCCAGG + Exonic
1029287966 7:99479062-99479084 CCTGGTTCCCCAGGGTGGCCAGG + Intronic
1032282425 7:130515222-130515244 CAAGGTTCCACAGGCTGTACAGG + Intronic
1033551651 7:142452924-142452946 CAAGGTCCCACTGCATGTCCTGG - Intergenic
1033553941 7:142471768-142471790 CAAGGTCCCACTGCATGTCCTGG - Intergenic
1033802936 7:144921895-144921917 CCATGTCCCTCAGTGTGCCCAGG + Intergenic
1034347797 7:150397756-150397778 CCCGGCCCCACAGCGTGTCCCGG - Exonic
1034468262 7:151242446-151242468 CCAGGTCTCTCCAGGTGTCCTGG - Intronic
1034533487 7:151712314-151712336 CCAGGCCACACAGGATGTCCAGG - Intronic
1034868182 7:154658517-154658539 CCAGGTACTTCAGTGTGTCCGGG + Intronic
1035072835 7:156157543-156157565 CCGGATGCCACAGGGTGTCCTGG + Intergenic
1035579394 8:730887-730909 CCAGGCCCCACCTGGTGTCTGGG - Intronic
1036104951 8:5829041-5829063 TCAGGTCCTACAGGTTTTCCCGG + Intergenic
1039449503 8:37660509-37660531 CCAGGTCCCCCTGGCTCTCCAGG + Intergenic
1045557135 8:103225603-103225625 CCAGATCCCACAAGGAGACCTGG + Intronic
1047360963 8:124169100-124169122 CCTGGTCACATCGGGTGTCCAGG + Intergenic
1047946280 8:129884056-129884078 CAAGGTCTCAAAGAGTGTCCTGG + Intronic
1048847409 8:138614166-138614188 CCTGGTCCCACAGGGGTTTCAGG + Intronic
1049201219 8:141341533-141341555 CGAGGTCTCACGGGGTGCCCAGG + Intergenic
1049367601 8:142248181-142248203 CCAGGTGCCACATCTTGTCCGGG - Intronic
1049668310 8:143858649-143858671 CCAGGTCCCGCAGGGTCTCGGGG + Exonic
1049668726 8:143860248-143860270 CCAGGTCCCGCAGGGTCTCGGGG + Exonic
1049669141 8:143861850-143861872 CCAGGTCCCGCAGGGTCTCGGGG + Exonic
1049669556 8:143863452-143863474 CCAGGTCCCGCAGGGTCTCGGGG + Exonic
1049669966 8:143865045-143865067 CCAGGTCCCGCAGGGTCTCGGGG + Exonic
1049724726 8:144140418-144140440 CCAAGCCCCACAGGCTGTCATGG + Exonic
1051500527 9:17771641-17771663 ACAGGTCTCACAGAGTGCCCTGG - Intronic
1052761916 9:32601418-32601440 CCAGGACCCACAGAGTCTTCAGG - Intergenic
1053522187 9:38791464-38791486 GCAGTGCCCACAGGGTTTCCAGG - Intergenic
1053691567 9:40589671-40589693 CCAGGTCCAACACAGTGCCCTGG - Intergenic
1054194413 9:62015928-62015950 GCAGTGCCCACAGGGTTTCCAGG - Intergenic
1054273235 9:63047814-63047836 CCAGGTCCAACACAGTGCCCTGG + Intergenic
1054401604 9:64717153-64717175 CCAGGTCCAACACAGTGCCCTGG - Intergenic
1054435207 9:65201462-65201484 CCAGGTCCAACACAGTGCCCTGG - Intergenic
1054495183 9:65820219-65820241 CCAGGTCCAACACAGTGCCCTGG + Intergenic
1054643994 9:67572762-67572784 GCAGTGCCCACAGGGTTTCCAGG + Intergenic
1055003646 9:71481941-71481963 CCATGTCCCCAAGGGTCTCCTGG - Intergenic
1055663542 9:78531096-78531118 CATGGTTCCACAGGCTGTCCAGG - Intergenic
1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG + Intronic
1057138725 9:92713957-92713979 GCTGGTCCCACAGGGTGATCGGG + Exonic
1058165286 9:101612009-101612031 CCAGGTCCCACAGGGCATTGTGG + Intronic
1059466070 9:114469620-114469642 GCAGGTCCCACAGGGAGCTCTGG - Intronic
1060458404 9:123823492-123823514 CCAAGTCACACAGGGTCTCATGG + Intronic
1061259162 9:129470116-129470138 CAAGGTCACACAGCGAGTCCAGG + Intergenic
1061513613 9:131075936-131075958 CCAGGTCCCGCTGGGTCTCTAGG - Exonic
1061836200 9:133331804-133331826 CAAGGACTCAGAGGGTGTCCTGG + Exonic
1062113800 9:134796863-134796885 CAAGGACCCACAGGATTTCCTGG + Exonic
1062381970 9:136290960-136290982 CCAGGTTTCACAGGCAGTCCAGG + Exonic
1185507837 X:643069-643091 CCAGGTCCCCAAGGCTCTCCCGG - Intronic
1185507953 X:643449-643471 CCAGGTCCCCAAGGCTCTCCCGG - Intronic
1185508053 X:643750-643772 CCAGGTCCCCAAGGCTCTCCCGG - Intronic
1185848752 X:3465283-3465305 CCAGGTCATGCAGGGTGTCTGGG + Intergenic
1195791390 X:108591587-108591609 CCAGGCCCCCCAGGATCTCCAGG + Exonic
1199966743 X:152826469-152826491 CCAAGTCCTACAGGATGTCAGGG + Intergenic
1200228494 X:154432382-154432404 TCAGCTCCCGCAGGGTGGCCAGG - Exonic
1201510060 Y:14749295-14749317 CCAGGCTGCACAGTGTGTCCAGG - Intronic
1202583361 Y:26403542-26403564 CCAGGTCCAACACAGTGCCCAGG + Intergenic