ID: 1165466331

View in Genome Browser
Species Human (GRCh38)
Location 19:35977195-35977217
Sequence AGGGTCTGCCATCCTGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165466331_1165466342 24 Left 1165466331 19:35977195-35977217 CCTATCCCAGGATGGCAGACCCT No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165466331 Original CRISPR AGGGTCTGCCATCCTGGGAT AGG (reversed) Intergenic
No off target data available for this crispr