ID: 1165466333

View in Genome Browser
Species Human (GRCh38)
Location 19:35977201-35977223
Sequence GCAGTGAGGGTCTGCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165466333_1165466342 18 Left 1165466333 19:35977201-35977223 CCAGGATGGCAGACCCTCACTGC No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165466333 Original CRISPR GCAGTGAGGGTCTGCCATCC TGG (reversed) Intergenic
No off target data available for this crispr