ID: 1165466342

View in Genome Browser
Species Human (GRCh38)
Location 19:35977242-35977264
Sequence CCTTGTACTTCCCGTGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165466336_1165466342 -4 Left 1165466336 19:35977223-35977245 CCCCATTTAATCCCTGAGACCTT No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data
1165466331_1165466342 24 Left 1165466331 19:35977195-35977217 CCTATCCCAGGATGGCAGACCCT No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data
1165466332_1165466342 19 Left 1165466332 19:35977200-35977222 CCCAGGATGGCAGACCCTCACTG No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data
1165466338_1165466342 -6 Left 1165466338 19:35977225-35977247 CCATTTAATCCCTGAGACCTTGT No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data
1165466334_1165466342 5 Left 1165466334 19:35977214-35977236 CCCTCACTGCCCCATTTAATCCC No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data
1165466337_1165466342 -5 Left 1165466337 19:35977224-35977246 CCCATTTAATCCCTGAGACCTTG No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data
1165466335_1165466342 4 Left 1165466335 19:35977215-35977237 CCTCACTGCCCCATTTAATCCCT No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data
1165466333_1165466342 18 Left 1165466333 19:35977201-35977223 CCAGGATGGCAGACCCTCACTGC No data
Right 1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165466342 Original CRISPR CCTTGTACTTCCCGTGATGC CGG Intergenic
No off target data available for this crispr