ID: 1165469619

View in Genome Browser
Species Human (GRCh38)
Location 19:35995786-35995808
Sequence AGCCCCGTGATGGACGGCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165469614_1165469619 2 Left 1165469614 19:35995761-35995783 CCTTGGCGACGCAGGGGGCCTAG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1165469619 19:35995786-35995808 AGCCCCGTGATGGACGGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
1165469613_1165469619 5 Left 1165469613 19:35995758-35995780 CCTCCTTGGCGACGCAGGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1165469619 19:35995786-35995808 AGCCCCGTGATGGACGGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165469619 Original CRISPR AGCCCCGTGATGGACGGCAA GGG Exonic
900407444 1:2498807-2498829 ACCCGCGTGGTGGACGACAACGG + Exonic
900885419 1:5411801-5411823 AACACCGTGAAGGACTGCAATGG + Intergenic
906075115 1:43046439-43046461 AGCCCCGAGATGGACTGCAGTGG + Intergenic
915512890 1:156396272-156396294 AGCCCAGGGATGGAGGGGAAAGG + Intergenic
920257323 1:204664436-204664458 GGCACAGTGATGGAGGGCAAAGG - Intronic
1063984890 10:11491717-11491739 AGCCCTGTGATGAAAGTCAATGG + Intronic
1070720625 10:78754440-78754462 AGCCCCGTGAGAGATGACAAGGG + Intergenic
1071507285 10:86240445-86240467 AGCCCCATGCTGGAGGGCCAGGG + Intronic
1081708971 11:45204937-45204959 AGCCCCCTGATGGAGGCCTAGGG - Intronic
1087373831 11:97319013-97319035 AGCTACGTGATGGACAGCAGAGG + Intergenic
1088842059 11:113635537-113635559 GGCCCCATGATGGAGGCCAAGGG + Intergenic
1090915301 11:131157621-131157643 AGACCCGTGGTCGTCGGCAAGGG + Intergenic
1095746087 12:45660578-45660600 AGTCCCGTGTTGGGCAGCAATGG - Intergenic
1097638474 12:62150169-62150191 AGCACTGTGATAGACGCCAAGGG + Intronic
1103754104 12:123189535-123189557 AGCCACATGATGGACGACACAGG + Intronic
1103862911 12:124028520-124028542 AGCCCCGTGTTTGAAGGCACTGG + Intronic
1103963659 12:124624766-124624788 AGCCCTGTGATGGTCTGCAAAGG + Intergenic
1109380882 13:61558204-61558226 AGCCCCATTAGGAACGGCAATGG + Intergenic
1122842102 14:104471001-104471023 AGCCCTGTGCTGGACTCCAAGGG - Intergenic
1122934605 14:104950157-104950179 GGCCCCCAGATGGACGTCAAGGG - Exonic
1137773785 16:51039550-51039572 AGCCACGTGAAGGATGGCTAGGG + Intergenic
1141980999 16:87550557-87550579 CGCCACCTGCTGGACGGCAAGGG - Intergenic
1142005955 16:87689729-87689751 AGCCCCGAGCTGTACCGCAAGGG + Exonic
1146916143 17:36679683-36679705 AGCCCCTTGATGAAAGGGAAAGG - Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1165469619 19:35995786-35995808 AGCCCCGTGATGGACGGCAAGGG + Exonic
925647767 2:6054581-6054603 AGCTCCATGATGTACGGCAGAGG + Intergenic
941889816 2:170568324-170568346 AGGCCAGTGATGGAAGGCCAGGG + Intronic
945589686 2:211714877-211714899 AGCCCAGTGGTGGATGGCATGGG - Intronic
1169113833 20:3049836-3049858 AGCCCCATGCTGGACAGCAGTGG - Intergenic
1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG + Intronic
1174231207 20:49046721-49046743 AGCGCCGTGATGGAGAGGAAAGG - Intronic
1174420111 20:50394017-50394039 AGCCCAGTGAGGGACGGCAGGGG + Intergenic
1179839187 21:44059546-44059568 AACCCCTGGATGGAAGGCAAAGG - Intronic
1181067059 22:20311757-20311779 AGCCCAGGGATGGAGGGAAAGGG + Intergenic
1183386905 22:37519868-37519890 AGCCCCGCGGGGGACAGCAATGG + Intergenic
1184743372 22:46442215-46442237 AGCCCCGTCCTGGAGGGGAAGGG - Intronic
967990265 3:195125351-195125373 AGCCCCGCAATGGAAGGAAATGG - Intronic
968439192 4:612987-613009 AGCACAGTGATGCAGGGCAAGGG - Intergenic
968569374 4:1331448-1331470 AGCCCCTTGATGGATAGCACGGG - Intronic
968963024 4:3754944-3754966 AGCCCAGTGATGGTTAGCAAGGG - Intergenic
971308616 4:25505325-25505347 AGCCCGGTCTTGGACGCCAAGGG + Intergenic
986800561 5:11255977-11255999 AGTCCCGTGATGGAGTGCAATGG - Intronic
1002299278 5:178248249-178248271 AGCGCCCTGCAGGACGGCAATGG + Exonic
1011060606 6:83262160-83262182 GGCCATCTGATGGACGGCAAAGG + Intronic
1015328453 6:131950895-131950917 AGCCTCGTGCTGGACGGCTGCGG - Exonic
1017820223 6:158043883-158043905 AGCCCTGCTTTGGACGGCAAGGG - Intronic
1019915663 7:4130610-4130632 AGCCCCGTGCTGGATGGCCCAGG + Intronic
1025250860 7:57350475-57350497 AGCCCAGTGAGGGACAGCAGGGG - Intergenic
1027774095 7:82443604-82443626 AGCCGCGCGGGGGACGGCAAGGG + Exonic
1029215230 7:98943389-98943411 CACCCCGTGATGGAAAGCAATGG - Intronic
1033972455 7:147058893-147058915 AGCCCTTTGAGGGACGGGAATGG - Intronic
1037792233 8:21955622-21955644 AACCCCTGGAAGGACGGCAAAGG - Intronic
1038441599 8:27574475-27574497 AGCCCTGTGATTCACTGCAAGGG + Intergenic
1044787488 8:95809876-95809898 AGCCCCATGTTGGACAGGAATGG - Intergenic
1049443172 8:142618372-142618394 AGCCCTGGGCTGGACAGCAAGGG - Intergenic
1061205225 9:129159155-129159177 AGCCCAGTGAGGGAGGGCACAGG + Intergenic
1186928132 X:14357774-14357796 AGCTCCCTGAGGGATGGCAATGG - Intergenic
1187226198 X:17376666-17376688 CGCCCCGTGAAGGACGTGAAAGG - Intronic
1200083479 X:153591245-153591267 AGCCCCGAGCTGGGAGGCAAAGG + Intronic