ID: 1165471548

View in Genome Browser
Species Human (GRCh38)
Location 19:36007327-36007349
Sequence TACAGAAGAGGGGTGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165471548_1165471557 0 Left 1165471548 19:36007327-36007349 CCCATCCCCACCCCTCTTCTGTA 0: 1
1: 0
2: 4
3: 38
4: 505
Right 1165471557 19:36007350-36007372 AGCTTCTGGAAACTTCTCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325
1165471548_1165471559 17 Left 1165471548 19:36007327-36007349 CCCATCCCCACCCCTCTTCTGTA 0: 1
1: 0
2: 4
3: 38
4: 505
Right 1165471559 19:36007367-36007389 CTGTGGCACAGTCCATCTCCGGG 0: 1
1: 0
2: 0
3: 20
4: 196
1165471548_1165471558 16 Left 1165471548 19:36007327-36007349 CCCATCCCCACCCCTCTTCTGTA 0: 1
1: 0
2: 4
3: 38
4: 505
Right 1165471558 19:36007366-36007388 TCTGTGGCACAGTCCATCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165471548 Original CRISPR TACAGAAGAGGGGTGGGGAT GGG (reversed) Intronic
900300276 1:1973585-1973607 GACAGAAGACGTGTGGGGAATGG + Intronic
900367486 1:2317140-2317162 TAGAGAGACGGGGTGGGGATGGG - Intergenic
901012481 1:6209535-6209557 TGCAGGTGAGGGGTGGGGGTTGG + Exonic
901451497 1:9339151-9339173 GACAGAAGAGGGGTGAGGGCAGG - Intronic
901505268 1:9681157-9681179 GAGAGAAGAGGGGAGGGGAGGGG + Intronic
901664253 1:10817422-10817444 TACAACAGAGGGGTGGGGGCAGG - Intergenic
901981464 1:13037857-13037879 GACAGTGGAGGGGAGGGGATGGG - Intronic
902000621 1:13191068-13191090 GACAGTGGAGGGGAGGGGATGGG + Intergenic
903007615 1:20309019-20309041 TGAAGAAGTGGGGTGGGAATGGG - Intronic
903279541 1:22242640-22242662 CACAGAACTGGGGTGGGGACAGG + Intergenic
905371832 1:37486583-37486605 TAGAGAAGTGGGATGGGGACTGG - Intergenic
905747863 1:40434688-40434710 TGCAGAAGATGGGTGGGTTTGGG + Intergenic
906177844 1:43791172-43791194 TACAGAAGGGGAGTGGGTACTGG - Intronic
906714236 1:47955110-47955132 TACAGAAGACATGTGTGGATGGG - Intronic
908381016 1:63596694-63596716 TGGAGAAGAGTGGTAGGGATGGG - Intronic
908843264 1:68299375-68299397 TACAGAAGAGCGGTAGGCTTGGG + Intergenic
909566254 1:77056661-77056683 CACAGAAGACGGGTGTGGAATGG + Intronic
910053960 1:83009210-83009232 GATAGAAGAGGGTTGGAGATTGG - Intergenic
910709539 1:90165493-90165515 TTCAGAAGCAGGTTGGGGATGGG + Intergenic
912506586 1:110160960-110160982 TAGAGCAGAGGGGTGGGAAGAGG + Intronic
912536040 1:110371869-110371891 TACAGAGGAGGTGTGGGGACCGG + Intronic
912806372 1:112759880-112759902 AAGAGAAGAGGGGAGGGGAGGGG + Intergenic
912941297 1:114047658-114047680 TGCAGCAGAGGGGTGGCAATGGG - Intergenic
913478517 1:119262303-119262325 TACAGAAGAGGGAAGAGGAGGGG - Intergenic
913581454 1:120231731-120231753 TACAAAGTAGGGGTGGGGAGGGG - Intergenic
913626722 1:120666657-120666679 TACAAAGTAGGGGTGGGGAGGGG + Intergenic
914237462 1:145824559-145824581 TACTGAGGCGGGGTGGGGACGGG + Intronic
914563386 1:148843177-148843199 TACAAAGTAGGGGTGGGGAGGGG - Intronic
914609441 1:149287046-149287068 TACAAAGTAGGGGTGGGGAGGGG + Intergenic
915356010 1:155255464-155255486 TAGAGAAGGGGGATGGGAATGGG + Intronic
915590149 1:156866207-156866229 GAAAGAAGAGGGGTCAGGATAGG + Intronic
917921687 1:179755889-179755911 TTCAGCAGAGAGGTGGGGAATGG - Intronic
918013640 1:180611174-180611196 CAAAGAAGAGGGGAGGGGCTGGG - Intergenic
918543544 1:185657625-185657647 GAGAGGAGAGGGGTGGGGAGGGG - Intergenic
920384620 1:205561691-205561713 TACAGGGGAGGGGAGGGGAGGGG + Intergenic
920676386 1:208041267-208041289 TAAAGAGGAGGGGTGGTGAACGG + Intronic
920705688 1:208248826-208248848 TTCAGAGGAGGGGTGGGGTAGGG + Intergenic
920734019 1:208514760-208514782 TACTGCAGAGGGGTGAGGGTGGG + Intergenic
920777011 1:208948712-208948734 GAGAGAAGAGGAGAGGGGATGGG + Intergenic
920854436 1:209651644-209651666 TCGACAAGAGGGGTGGGGCTGGG + Intronic
921835508 1:219774158-219774180 TAGAGAAGAGTGCTGGGGAAAGG + Intronic
922022041 1:221715388-221715410 TATAGAAAAGAGCTGGGGATTGG + Intronic
924620280 1:245654300-245654322 TAATGATGAGGGGTGGGGAGGGG + Intronic
1063971183 10:11382300-11382322 CACAGGAGAGGGGTGAGAATGGG - Intergenic
1064267629 10:13837759-13837781 TGCAGAAGAGGAGTGGGATTGGG - Intronic
1065256859 10:23878738-23878760 TAGAGAAAAGTGGTGGGGTTTGG + Intronic
1065427030 10:25616468-25616490 GCCAGAAGAGGGGTGGAGAAAGG - Intergenic
1065773246 10:29096878-29096900 TAGACAAGAAGGATGGGGATGGG - Intergenic
1065856792 10:29837821-29837843 TACAGTAGATGGGAGGTGATGGG + Intergenic
1067229651 10:44397418-44397440 GACAGGAGAGGGGAGGGGAAGGG + Intergenic
1067370817 10:45680055-45680077 TCTAAAAGAGAGGTGGGGATTGG + Intergenic
1067382960 10:45792212-45792234 TGCTGAAGAGGGGTGGAGAAAGG - Intronic
1067388960 10:45846089-45846111 TCTAAAAGAGAGGTGGGGATTGG - Intronic
1067417103 10:46110858-46110880 TCTAAAAGAGAGGTGGGGATTGG + Intergenic
1067502519 10:46817752-46817774 TCTAAAAGAGAGGTGGGGATTGG + Intergenic
1067575609 10:47406549-47406571 TACAGAGGAGGGATGGAGAGGGG - Intergenic
1067592070 10:47522267-47522289 TCTAAAAGAGAGGTGGGGATTGG - Intronic
1067639188 10:48030339-48030361 TCTAAAAGAGAGGTGGGGATTGG - Intergenic
1067772224 10:49135063-49135085 TAGAGGAGAGGGGAGGGGAGGGG - Intergenic
1067874298 10:49989953-49989975 TCTAAAAGAGAGGTGGGGATTGG + Intronic
1067890660 10:50132757-50132779 TGCTGAAGAGGGGTGGAGAAAGG - Intronic
1069515228 10:69072007-69072029 TAAAGAAGTGGGGTGGGGGGGGG + Intergenic
1069559702 10:69420753-69420775 TAGAGAAGAGGAGTGAGGCTGGG + Intergenic
1070136179 10:73696499-73696521 TCTAAAAGAGAGGTGGGGATTGG - Intronic
1070279984 10:75041520-75041542 TACAGCGGAGGGGTGTGGGTAGG - Intronic
1070402822 10:76068412-76068434 CACAGACTGGGGGTGGGGATGGG + Intronic
1072581083 10:96740714-96740736 TACAGAAGAAGGGGTGGGAAAGG - Intergenic
1072845923 10:98830304-98830326 TGAAGAAGAGGGGTAGGGAGAGG + Intronic
1073138994 10:101235628-101235650 GACAGAAGATGGGAGGTGATGGG + Intergenic
1073218641 10:101851500-101851522 GACAGAAGGGGGTTGGGGGTTGG + Intronic
1073463049 10:103677487-103677509 TGCAAGACAGGGGTGGGGATGGG + Intronic
1073709651 10:106022142-106022164 TAGAGAAAAGGGGTGGGGGTGGG + Intergenic
1074697086 10:116059327-116059349 TACAGAAGAAAATTGGGGATTGG + Intronic
1074877601 10:117626186-117626208 TCCAGAACAGGGGTGAGGAGAGG - Intergenic
1075192159 10:120319466-120319488 AACAGAAGAGAGCTGGGGTTTGG + Intergenic
1076943455 10:133626092-133626114 AACAGAAGAGAGCTGGGGTTTGG - Intronic
1077060073 11:614091-614113 TTTAGAAGGGGGCTGGGGATTGG - Intronic
1077387120 11:2275317-2275339 TACAGCAGAGGGCAGGGGAGAGG - Intergenic
1077879618 11:6338627-6338649 TATAGAAGTGGGTTGGGGGTGGG - Intergenic
1080377214 11:31726326-31726348 TACAGAAGAGGGTGGAGGAAAGG + Intronic
1080436363 11:32248686-32248708 TCCAGATGTGGGGTGGGGTTTGG - Intergenic
1080529465 11:33161156-33161178 TATAGAAGAGTGGTGGGAATGGG - Intronic
1081352017 11:42065965-42065987 TACAGAGGAGGGGAAGGGAAGGG + Intergenic
1081709977 11:45210261-45210283 GGGAGAAGAGGGGTGGGGAGCGG - Intronic
1081800234 11:45853764-45853786 TCCAGAAGAGTGGTGAGGCTTGG + Intronic
1082116559 11:48335908-48335930 TGCACAAGAGGGCTGTGGATTGG + Intergenic
1082223910 11:49677727-49677749 AAGAGAAGAGGGGAGGGGAGGGG - Intergenic
1082806794 11:57457005-57457027 TTCAGAAGATGGGAGGGGCTGGG - Intergenic
1083151094 11:60792182-60792204 TGGAGAATAGGGGTGGGGGTGGG + Intronic
1083192463 11:61062041-61062063 TACAGAATTGGGGTGGGGTGGGG + Intergenic
1083489920 11:63008772-63008794 TACAGAAGACGGGGGGTGTTGGG - Intronic
1083630159 11:64091148-64091170 GATAGAAGAGGGATGGGGAGGGG + Intronic
1083727427 11:64635978-64636000 GCCAGGAGAGGGGTTGGGATGGG - Intronic
1084344382 11:68535219-68535241 TCCAGACGAGGGGTGGGTAGGGG - Intronic
1085565825 11:77512469-77512491 TACAGGCCAGGAGTGGGGATGGG + Intergenic
1085670527 11:78460088-78460110 CACAGAAGAAGGGTGGTGATAGG + Intronic
1085928123 11:81047019-81047041 TGCAGAAGAGAGGAAGGGATTGG + Intergenic
1086123003 11:83319692-83319714 TCCCTAAGATGGGTGGGGATAGG + Intergenic
1086625133 11:88941465-88941487 AAGAGAAGAGGGGAGGGGAGAGG + Intronic
1087027069 11:93660701-93660723 TAAAAATGGGGGGTGGGGATGGG - Intergenic
1087765903 11:102152967-102152989 GACAGGAGAGGAGTGGGGATGGG + Intronic
1088645155 11:111912012-111912034 CAGAGAACAGGGGTGGGGGTGGG - Intronic
1088849972 11:113696351-113696373 TAGAGAAGAGGGCTGTGGAATGG - Intronic
1088985947 11:114908414-114908436 TAAGGGAGAGGGGTGGGGTTGGG + Intergenic
1089116198 11:116097091-116097113 CAGAGGAGTGGGGTGGGGATGGG - Intergenic
1089145610 11:116327823-116327845 GACAGAGGAGGGGAGGGGAGGGG - Intergenic
1089320010 11:117619290-117619312 TACAGCAGAGGCGTGGCTATTGG + Intronic
1089438488 11:118493399-118493421 TTCAGAAGAAGGGTTGTGATAGG + Intronic
1089562523 11:119351473-119351495 GACAGAGGAGGGGAGGGGATGGG - Intergenic
1090118277 11:123998002-123998024 TACAGAAGAGAGTTGGGACTAGG - Intergenic
1090406457 11:126478429-126478451 CTCAGAAGGGGAGTGGGGATGGG + Intronic
1092163696 12:6329816-6329838 TTCTGAAGGGGGTTGGGGATGGG + Exonic
1093149181 12:15601687-15601709 GAAAGAAGAGGGGTGGGGGAGGG - Intergenic
1094097287 12:26721018-26721040 TTCAGTGGAGGGCTGGGGATGGG + Intronic
1094174818 12:27530609-27530631 TACAGAAAAGGAGGGGGGAATGG - Intronic
1096201127 12:49683993-49684015 CACAGTAGAGAGGTGGGGCTTGG - Intronic
1096259734 12:50083049-50083071 GACAGAAGGGAGCTGGGGATTGG + Exonic
1096865320 12:54559255-54559277 AAGAGAAAAGGGGTGGGGGTGGG - Intronic
1097035219 12:56119435-56119457 CACAGTAGTGGGGTGGGGGTAGG + Intronic
1097409619 12:59235186-59235208 TATAGAAGTGTGGTGTGGATTGG + Intergenic
1098030696 12:66250526-66250548 TACAGAGCAGTGGTGGGCATGGG - Exonic
1098069254 12:66654370-66654392 TACAGAAGAGGGTTGTAGAGAGG + Intronic
1099530884 12:83779642-83779664 TACAGAAGTAGGGTGGAGAATGG - Intergenic
1100564439 12:95781784-95781806 AACAAAACAGGGGAGGGGATGGG - Intronic
1100875246 12:98955187-98955209 TAGAGAAGAGGGCTTGGAATTGG + Intronic
1101014646 12:100487487-100487509 TCCAGGACAGGGGTGGGGAATGG + Intronic
1101420494 12:104546786-104546808 AACAAAAGAGAAGTGGGGATAGG + Intronic
1101709797 12:107254684-107254706 AGCAGGAGAGGGGTGGGTATAGG - Intergenic
1102487066 12:113265791-113265813 TAAAAAAGAGGGGAGGGGCTGGG - Intronic
1103438828 12:120947915-120947937 CACAGAAAAGGGGAGGGGAGAGG - Intergenic
1103698328 12:122835012-122835034 TTCGGAGGAGGGGTGGGGAGAGG + Intronic
1103810701 12:123611303-123611325 AACAGAACAGGGGTGAGGAGTGG - Intronic
1104601120 12:130154176-130154198 GACAGAAGAGGTGTGTGGAGAGG - Intergenic
1105704953 13:22962881-22962903 GACAGAAGAGGGGAGGAGAGAGG + Intergenic
1106627413 13:31434654-31434676 TACAGAATAGGGGACGGGATGGG + Intergenic
1106971081 13:35142685-35142707 AAAAACAGAGGGGTGGGGATGGG - Intronic
1108184582 13:47875797-47875819 TCAAAAAGAGGGGTGGGGATGGG + Intergenic
1108243952 13:48496784-48496806 AAGAGAAGAGGGGAGGGGAGAGG + Intronic
1108781571 13:53842832-53842854 TATAGAAGAGTGGTGGGGGATGG - Intergenic
1109904520 13:68821179-68821201 AACAGAAGAGCACTGGGGATGGG + Intergenic
1111453896 13:88454154-88454176 TACAGAATGGGGGGTGGGATGGG + Intergenic
1111589362 13:90323635-90323657 TGCAGGAGAGGAGTGGGGGTGGG + Intergenic
1112194398 13:97210959-97210981 TGGAGAAGAGGGGTGGTGAAAGG + Intergenic
1112282502 13:98075229-98075251 TACAGAGAAGGGGTGGGAATAGG + Intergenic
1113010924 13:105764975-105764997 GAAAGAAGAGGGGAGGGGAAGGG - Intergenic
1113348090 13:109500254-109500276 GACAGAAGCAGGATGGGGATAGG + Intergenic
1114517897 14:23311907-23311929 TATAGGAGTGGGGTGAGGATGGG - Intronic
1114530506 14:23392654-23392676 TGCAGGAGAAGGGTGGGGGTGGG + Intronic
1115260211 14:31444436-31444458 TGCAGAAAAGGAATGGGGATAGG + Intronic
1115474148 14:33798314-33798336 TCTGGAAGAGGGCTGGGGATGGG - Intronic
1115992093 14:39160605-39160627 AAAAGAAGAGGGGAGGGGAGGGG + Intronic
1116608452 14:47033785-47033807 TATAGAAGAGGGGCAGGGAATGG + Intronic
1116770862 14:49125518-49125540 AGCAGAGGAGGGGTGGGGACAGG + Intergenic
1116919430 14:50557320-50557342 TACGGGAGATGGGTGGGAATAGG - Intronic
1116987715 14:51239100-51239122 TTCAGTGGAGGGGTGGGGAAGGG + Intergenic
1117838743 14:59835313-59835335 GACAGAAAAGGGGCGGGGAGAGG + Intronic
1118458540 14:65966907-65966929 GACACAAGAGGGGAGGTGATGGG + Intronic
1119865206 14:77967380-77967402 CACAAAAGTGGGGTGGGGAGTGG - Intergenic
1120817679 14:88880683-88880705 ACCAGAAGAGGGGTGGGGTTTGG - Intronic
1121598837 14:95187471-95187493 TCCAGGAGAGGCTTGGGGATTGG + Exonic
1121736129 14:96219405-96219427 CACAGGGGAGGGGTGGGGACCGG + Intronic
1121739160 14:96239400-96239422 TTCAGCAGAGGCGTGGGGCTTGG - Intronic
1121860258 14:97310577-97310599 TACATGAGAGGGGAGGGGAGGGG - Intergenic
1122035549 14:98946699-98946721 TGCAGGAGTGGGGTGGGGGTGGG - Intergenic
1122791400 14:104185570-104185592 TAGAGAGATGGGGTGGGGATAGG + Intergenic
1122803164 14:104242755-104242777 AAAAGAAGAGGGGAGGGGAGGGG - Intergenic
1123058194 14:105582290-105582312 TACAGTACAGGAGTGGGGACAGG - Intergenic
1123082285 14:105701215-105701237 TACAGTACAGGAGTGGGGACAGG - Intergenic
1126103676 15:45134529-45134551 GAAAGATGAGGGGTGGGGTTAGG + Intronic
1126167598 15:45666918-45666940 GAGAGGAGAGGGGAGGGGATGGG - Intronic
1126167608 15:45666947-45666969 GAGAGGAGAGGGGAGGGGATGGG - Intronic
1126182999 15:45804175-45804197 TACAGAAGAGGGGCTGGAATGGG + Intergenic
1126459001 15:48895554-48895576 GACAGCAGAGGGCTGGGGAAGGG - Intronic
1126526350 15:49659199-49659221 GAAAGAAGAGGGGAGGGGAGGGG + Intergenic
1128096446 15:64960063-64960085 CACAGAGGATGGGTGGGGGTGGG + Intergenic
1128368137 15:67019273-67019295 TACAGAGGAGAGGTGGAGATAGG - Intergenic
1129063482 15:72880786-72880808 AAGAGAAGAGGGGAGGGGAGGGG + Intergenic
1129221872 15:74135907-74135929 GCCAGAAGTGGGGTGGGGGTGGG - Exonic
1129503930 15:76065304-76065326 TTCAGTAGAGGGGTGGGGGCAGG - Intronic
1129655481 15:77521862-77521884 TACAGAGGTAGGGTGGGAATGGG + Intergenic
1131348415 15:91672970-91672992 TACAGATGTGGGCAGGGGATAGG - Intergenic
1131685930 15:94767507-94767529 GACAGGAGAGGGGAGGGGAGGGG + Intergenic
1131804106 15:96103952-96103974 CACAGAAGAAGGGGTGGGATGGG + Intergenic
1132818468 16:1847593-1847615 AAGAGAAGAGGGGAGGGGAGGGG + Intronic
1133317301 16:4892680-4892702 TACAGAAGAGGATCTGGGATTGG - Intronic
1133669669 16:8006242-8006264 TAAAGTAATGGGGTGGGGATAGG - Intergenic
1133962943 16:10510366-10510388 AAAAGAAGAGGGGAGGGGAGGGG + Intergenic
1134336078 16:13300828-13300850 GAGAGAAGAGGGGAGGGGAGGGG - Intergenic
1134463558 16:14451601-14451623 TTCAGAAGAATGGTGGGTATGGG + Intronic
1134573421 16:15311425-15311447 TACTGAAGAGGGCTTGGGCTGGG - Intergenic
1134728962 16:16444537-16444559 TACTGAAGAGGGCTTGGGCTGGG + Intergenic
1134938473 16:18267329-18267351 TACTGAAGAGGGCTTGGGCTGGG - Intergenic
1135149825 16:19995676-19995698 AACACAAGAGAGGTGGGCATGGG - Intergenic
1135420396 16:22302014-22302036 AAGAGAAGAGGGGTGGTCATAGG - Intronic
1135731087 16:24895555-24895577 GACAGGAGAGGGGAGGGGAAGGG + Intronic
1135895603 16:26399199-26399221 AACATGAGAGGGGTGGGGAGGGG - Intergenic
1136015167 16:27393343-27393365 AACAAAAGAGGGGGAGGGATAGG + Intergenic
1137295113 16:47084960-47084982 CACAGAACAGGGGTGGGGCAGGG - Intronic
1137626905 16:49914817-49914839 TGCAGAAGAGGTGGGGGGAGGGG + Intergenic
1138649247 16:58449334-58449356 TACAGAAGAGGGCTTGGGTGAGG + Intergenic
1139290529 16:65854242-65854264 AGCAGAGGAGTGGTGGGGATGGG + Intergenic
1139490438 16:67283164-67283186 GGCAGAAGAGGGTTGAGGATGGG + Intronic
1139548692 16:67661666-67661688 TGCAGAAGCGGGGTGAGGAGGGG + Exonic
1139598326 16:67970656-67970678 TCCAGATGAGGGGTGGGGTGGGG - Intergenic
1139908741 16:70383575-70383597 GAAAGGAGAGGGGTGGGGAGGGG + Intronic
1140522909 16:75597517-75597539 CACAGATCCGGGGTGGGGATAGG + Intronic
1141382556 16:83589230-83589252 GAGAGAAGAGGGAGGGGGATGGG - Intronic
1141384229 16:83604413-83604435 TACACCACCGGGGTGGGGATAGG + Intronic
1142480689 17:216366-216388 CACAGAATGGGGGTGGGGGTGGG + Intronic
1142805045 17:2367134-2367156 CACAGAAGAGGGGAAGGGAGGGG - Intronic
1143217077 17:5233207-5233229 GGCTGAAGCGGGGTGGGGATGGG - Intronic
1143231500 17:5359414-5359436 TACTGAAGAGGGAAGGGGCTAGG - Intronic
1143447158 17:7016425-7016447 AACAGAAGAGGGGACGGGAGGGG - Intronic
1143476387 17:7205857-7205879 TCCAGGATAGGGATGGGGATGGG - Intronic
1143672316 17:8405239-8405261 GAGAGAAGAGAGGTGGGGAAGGG + Intergenic
1143742478 17:8964826-8964848 TAGAGAGGAGGGGTGGGTTTAGG - Intronic
1143887602 17:10076364-10076386 GACAGAAAAGGGGAGGGGAAGGG + Intronic
1143900335 17:10169698-10169720 TGGAGAAGAGGTCTGGGGATGGG - Intronic
1144048013 17:11470705-11470727 TTCTGAGGAGGGGTGGGGGTGGG + Intronic
1145242225 17:21246755-21246777 AGCAGAGGAGGGGTGGGGAGGGG + Intronic
1146809331 17:35890746-35890768 GACAGAAGAGGGGAGGGGGAGGG - Intergenic
1146948910 17:36892365-36892387 GAGAGAAGAGGGCTGGGGAACGG - Intergenic
1147059509 17:37863554-37863576 AAAAGAAGAGGGGAGGGGAAGGG + Intergenic
1147159734 17:38562998-38563020 TAGAGAAGAGGGGTGGCCAGAGG + Intronic
1147606219 17:41775241-41775263 GACAGAAGAAGGCTGGGGGTGGG + Intronic
1147615674 17:41825821-41825843 GACAGACGAGGGATGGGCATGGG + Intronic
1147996257 17:44362026-44362048 TTCAGAAGAGGGAGGGGGCTGGG + Intronic
1148158684 17:45437647-45437669 TGCAGCAGAGGGGTGGGGGGAGG + Exonic
1148325273 17:46779662-46779684 CACAGAACTGGGGTGGGGATGGG - Intronic
1148408785 17:47446058-47446080 AAAAGAAGAGGGGAGGGGAAGGG + Intergenic
1148425955 17:47596189-47596211 TGCAGAAGAGGGGTGGCAAGGGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148688189 17:49512478-49512500 AAGAGAGGAGGGATGGGGATAGG + Intronic
1148869702 17:50649613-50649635 GAGAGATGAGGGGTGGGGAGGGG + Intronic
1150390105 17:64785046-64785068 TGCAGCAGAGGGGTGGGGGGAGG + Intergenic
1151050959 17:70978402-70978424 GAAAAAAGAGGGATGGGGATGGG + Intergenic
1151496212 17:74459771-74459793 TCCAGGAGAGGGGAGGGGCTAGG - Intergenic
1151985775 17:77542570-77542592 ATCAGAAGACGGGTGGTGATGGG + Intergenic
1152155739 17:78631688-78631710 GAGAGAAGAGGGGAGGGGAGGGG + Intergenic
1152155749 17:78631718-78631740 GAGAGAAGAGGGGAGGGGAGGGG + Intergenic
1152325254 17:79632286-79632308 TACAGATGAGGGGTGGGGCCGGG + Intergenic
1153319158 18:3754590-3754612 TATAAAAGAGGGGTGGGGGGTGG + Intronic
1153718031 18:7870610-7870632 TAATGAAGAGAGGAGGGGATGGG - Intronic
1153843252 18:9026007-9026029 TACAGAGGGGGAGTGGGGAGTGG + Intergenic
1155217175 18:23653626-23653648 TATAAAAGAGGGGAGGGGAGGGG - Intronic
1155507221 18:26546204-26546226 TAAAGAAAAGGGGTGGAGAGTGG - Intronic
1155550501 18:26959940-26959962 TTCAGATGAGGGGTTAGGATGGG + Intronic
1156231068 18:35154307-35154329 AAAAGCAGAGGGTTGGGGATAGG + Intergenic
1156438098 18:37155388-37155410 TACAGAGGAGGATTGGGGAAGGG - Intronic
1156659134 18:39326002-39326024 AAGAGAAGATGGGTGGGGAGGGG + Intergenic
1157407852 18:47438515-47438537 TCCAAAAGAAGGGAGGGGATAGG - Intergenic
1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG + Intergenic
1158774732 18:60563720-60563742 TACAGAAGAGCTGTGGGGATCGG - Intergenic
1159493016 18:69162980-69163002 AACAGGAGAGGGGAGGGGAAGGG - Intergenic
1159877783 18:73830895-73830917 TACAGAAGATGGGGTGGGGTAGG - Intergenic
1160079082 18:75705262-75705284 GACAGAAGAATAGTGGGGATGGG + Intergenic
1160173475 18:76573264-76573286 CACAGGAGTGGGGTGGGGATGGG + Intergenic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160762204 19:791362-791384 AAAAAAAGAGGGGTGGGGCTTGG - Intergenic
1160928766 19:1559939-1559961 TACAGAAGAATGGAGGGGACTGG - Intronic
1161004467 19:1927843-1927865 TACCGAAGGGGTGTGGGGATGGG + Intergenic
1161204457 19:3033831-3033853 TAGAGATGGGGGGTGGGGGTTGG - Intronic
1161793571 19:6374441-6374463 TGCAAAAGAGGCGTGGGGATGGG - Intronic
1161864635 19:6825131-6825153 GACCCAAGAGGGCTGGGGATCGG - Intronic
1162111941 19:8404121-8404143 TGCAGGAGAGGGGAGGGGAGAGG - Exonic
1162548121 19:11343200-11343222 AACAGCACAGGGGTGGGGGTGGG + Intronic
1162948725 19:14058277-14058299 TACAGAAGTGGGGTGCAGATAGG + Intronic
1163050218 19:14677521-14677543 GAGAGATGAGGGGTGGGGGTGGG + Intronic
1163174162 19:15552511-15552533 TATAGCAGAGGGATGGGGATGGG + Intergenic
1163174856 19:15557127-15557149 TGGAGAAGAGGGATGGGGAAGGG - Intergenic
1163597687 19:18229876-18229898 AAGAGAAGTGAGGTGGGGATGGG - Intronic
1163612915 19:18310294-18310316 TCCAGAAGTGAGGTGGGGCTGGG - Intronic
1163727110 19:18929073-18929095 TGCAGATGAGGGGTGAGGCTTGG - Intronic
1164524567 19:29003921-29003943 CAGAGAAAGGGGGTGGGGATGGG - Intergenic
1164996224 19:32721261-32721283 CAGAGCAGAGGGGTGGGTATGGG + Intronic
1165078384 19:33293628-33293650 CAGAGAAAGGGGGTGGGGATGGG - Intergenic
1165242257 19:34478202-34478224 TCCAGGAGAAGGATGGGGATGGG - Intergenic
1165308924 19:35019068-35019090 CACAGAGGAGTGGTGGGGATTGG + Intronic
1165471548 19:36007327-36007349 TACAGAAGAGGGGTGGGGATGGG - Intronic
1165922732 19:39308711-39308733 TACAGATGAGGGGTGTGAAAGGG - Intronic
1166262173 19:41647943-41647965 TTCATAACAGGGGTGGGGATGGG + Intronic
1167259442 19:48450289-48450311 TGCAGAAGAGCGGTGGGGGAAGG - Intronic
1167344389 19:48936168-48936190 TAAGGAAGAGGGCTCGGGATCGG - Exonic
1168307721 19:55444528-55444550 TGCAGAAGAGAGGTGGGAGTTGG + Intergenic
1168337273 19:55603745-55603767 TAGAGATAAGGGGTGTGGATTGG + Intergenic
1168509285 19:56961589-56961611 AAGAGAAGAGGGGAGGGGAGGGG - Intergenic
925064790 2:921593-921615 CACAGCAGAGGGGCAGGGATGGG - Intergenic
925106949 2:1299801-1299823 TACAGATGACAGGTGGGGTTTGG - Intronic
925310288 2:2876870-2876892 TACAGAGGTGGGGTGGAGTTGGG - Intergenic
925883479 2:8372224-8372246 TACAAAAGAGAGATGGGAATGGG + Intergenic
926305301 2:11633763-11633785 TAGTGAGGAGGGGTGGGGCTGGG - Intronic
927884558 2:26710486-26710508 CAGAGAAGAGGGGAGGGGCTTGG + Intronic
929585097 2:43108605-43108627 TACAGTGGAGGTGTGGGGGTGGG + Intergenic
929717800 2:44331236-44331258 TACAGAAGAAGTGTAGGGCTAGG - Intronic
929794637 2:45049579-45049601 AAAGGAAGAGGGGTGGGGAAGGG + Intergenic
930016533 2:46974703-46974725 TACAGAGGAGGGGTCAGGAGTGG + Intronic
930639491 2:53840538-53840560 GAGAGAAGAGGGGAGGGGAGGGG + Intergenic
931706225 2:64948486-64948508 TAGAGAAAAGGGGTGGGGTGTGG + Intergenic
932614487 2:73223308-73223330 GAATGAAGTGGGGTGGGGATGGG + Intronic
932871746 2:75407625-75407647 CAGAAAAGAGGGGTGGGGATTGG + Intergenic
933898503 2:86832972-86832994 GAGAGAAGAGGGGAGGGGAGGGG - Intronic
934896729 2:98126023-98126045 TACAGGAGAGTGGGGGGGATAGG + Intronic
935677897 2:105611362-105611384 TACAGAAGAGGGATATGGAATGG - Intergenic
935695018 2:105763617-105763639 TACAGCAGTGGGGTTGGGGTTGG + Intronic
936469507 2:112786393-112786415 TACAACAGAGGAGTGAGGATGGG - Intergenic
937403638 2:121607827-121607849 TTGAGATTAGGGGTGGGGATGGG - Intronic
938082759 2:128378949-128378971 TCCAGGGGAGGGGTGGGGCTGGG + Intergenic
938124849 2:128664374-128664396 GAGAGAAGAGGGGAGGGGAGGGG - Intergenic
938124880 2:128664446-128664468 GAGAGAAGAGGGGAGGGGAGGGG - Intergenic
939606713 2:144262930-144262952 GAGGGAAGAGGGGAGGGGATAGG + Intronic
939606746 2:144263002-144263024 GACAGAGGAGGGGAGGGGAGGGG + Intronic
939719092 2:145625046-145625068 TACAGAAGAGGAGGGGAGAGAGG - Intergenic
940468479 2:154063062-154063084 TACAGAAGGGTGTTGGGGAGAGG + Intronic
940532609 2:154898296-154898318 TACTGAATAGGAGTGGGAATAGG - Intergenic
941773301 2:169364905-169364927 AGCAGAAAAGGGGTAGGGATGGG + Intergenic
941865930 2:170334692-170334714 AAAAAAAGAGGGGTGGGGATGGG - Intronic
942077642 2:172371428-172371450 TTCAGATGTGGGGTGGGGAAGGG - Intergenic
942633039 2:177972653-177972675 TAAAGAAGATGGGTGGGCAAAGG + Intronic
943225534 2:185169485-185169507 TACAGCAGGGAGGTGGGGAGTGG - Intergenic
944177671 2:196850877-196850899 AAAAGAACAGGGATGGGGATTGG + Intronic
945976892 2:216277912-216277934 GACAGAAGAGGGGTGGGAATGGG - Intronic
946535490 2:220623319-220623341 TACTGAAGAGTGATGGGGATGGG + Intergenic
946730150 2:222701671-222701693 GAGAAAAGAGGGGTGGGCATGGG + Intronic
947112618 2:226735192-226735214 TACAGAAGTGGTGGGGGGAGGGG + Exonic
947139732 2:227009751-227009773 AAGAGAAGAGGGGAGGGGAGGGG + Intronic
947506923 2:230714049-230714071 TGCAGAAGAGGTGTGTGGAAGGG + Intronic
947756250 2:232567571-232567593 TGCAGAAGTGGGGTGAGGGTGGG - Intronic
948313774 2:237010991-237011013 TACAGATGAGGAATGGGGAGGGG - Intergenic
948579121 2:238972045-238972067 CACACCAGAGGTGTGGGGATGGG - Intergenic
948840107 2:240644675-240644697 GAGAGAAGAGGGGAGGGGAGGGG - Intergenic
1170876419 20:20254111-20254133 GATAGAAGAGGGGAGGGGAGGGG - Intronic
1171415311 20:24975134-24975156 TACTGAAAAGGAGTGGTGATAGG - Intronic
1171780826 20:29416260-29416282 AACAGAAGAGAGCTGGGGTTTGG - Intergenic
1172330723 20:34074546-34074568 CACAGGGGCGGGGTGGGGATGGG - Intronic
1172573657 20:35989885-35989907 GAGAGAAGAGGGGAGGGGAGGGG + Intronic
1173334221 20:42099862-42099884 TTCAGAAGAGGGGTCTGGGTGGG + Intronic
1173826639 20:46051892-46051914 GACAGAAGAGGGGTGGGGCTGGG + Intronic
1173836172 20:46127688-46127710 TATAGAAGAGTGGAGGGGAAAGG - Intronic
1175306237 20:57977482-57977504 CACAGAAGTGGGGTGGGGGGTGG + Intergenic
1176056241 20:63150730-63150752 CACAGATGAGGGGTGGGGGCTGG - Intergenic
1179249818 21:39663460-39663482 AAAAGAAGAGGGAAGGGGATGGG - Exonic
1179874778 21:44262194-44262216 TTCAGGGGAGGGGTGGAGATGGG + Exonic
1180638060 22:17276417-17276439 AAGAGAAGAGGGGAGGGGAGGGG + Intergenic
1181579616 22:23820756-23820778 GAGAGAAGTGGGGTGGGGATGGG + Intronic
1182764877 22:32751391-32751413 TAAAGAAGAGGGGTGGGGTAGGG + Intronic
1182804718 22:33059715-33059737 AGCAGCAGAGGGGTGGGGAGAGG - Intergenic
1182944928 22:34312892-34312914 ATGACAAGAGGGGTGGGGATGGG + Intergenic
1183741858 22:39673159-39673181 CACAGGAGTGGGGTGGGGAGGGG + Intronic
1183921722 22:41174943-41174965 AACAAAAAAGGGGTGGTGATGGG - Intronic
1183997731 22:41648059-41648081 AACAGAAGAGAGGAGGGGAGAGG - Intronic
1184379574 22:44136622-44136644 TACAGAGAAGGGGTGTGGAGCGG - Intronic
1184395710 22:44237417-44237439 GTCAGAAAAGGGGTGGGGGTGGG - Intergenic
1203299452 22_KI270736v1_random:66869-66891 TACAGAAGAGTGGAATGGATTGG + Intergenic
949757045 3:7424111-7424133 TACAGATGAGGGGATGGGAAAGG - Intronic
949986465 3:9545100-9545122 ACAAGAAGAGGGGTGGGGAGAGG + Intronic
950167775 3:10814759-10814781 TTCAGAGGAGTGGTGGGGGTGGG + Intergenic
950354268 3:12391365-12391387 TCCAGAAGAGAGGTGGGGCAGGG + Intronic
950729288 3:14942743-14942765 TAAAAAAAGGGGGTGGGGATAGG + Intergenic
953794646 3:45975211-45975233 TACAGGACAGGGCTGGGGTTTGG - Intronic
954093916 3:48307538-48307560 TCCAGAAGAGGTGGGGGGGTGGG - Intronic
954366029 3:50146680-50146702 GACAGAGGAGGGGTGAGGAAGGG - Intergenic
954671994 3:52296188-52296210 TACAGCAGAGGGCGGGGGTTGGG + Intergenic
955147906 3:56338467-56338489 TACAGAAGAGGTGAGAAGATGGG + Intronic
956078373 3:65530878-65530900 GAAAGAGGAGGGGTGGGGTTTGG + Intronic
957084177 3:75665011-75665033 AACAGAAGAGAGCTGGGGTTTGG + Intronic
957319331 3:78608782-78608804 TACAGTACAGGGGTGGGGGGAGG + Intronic
959613750 3:108323851-108323873 TACATAAGTGGAGTGGAGATAGG - Intronic
960740945 3:120832782-120832804 AAGAGAAGAGGGGAGGGGAGGGG - Intergenic
960855621 3:122099324-122099346 TTCAGTAGAGAGGTGGGGGTGGG + Intronic
961012146 3:123443527-123443549 GACAAATGAGGGGTGGGGGTAGG - Intronic
961639622 3:128357140-128357162 TACAGAGCAGGGGTGGGGTGAGG + Intronic
961823036 3:129584978-129585000 AGCAGAACAGGGGTGGGGAGCGG - Intronic
963285255 3:143428903-143428925 GGCTGCAGAGGGGTGGGGATGGG + Intronic
963360761 3:144269393-144269415 TTCAGGAGATGGGTGGCGATGGG + Intergenic
963633047 3:147758028-147758050 AACTGCTGAGGGGTGGGGATGGG + Intergenic
963862489 3:150325377-150325399 AAAAGTAGAGGGATGGGGATGGG - Intergenic
963946073 3:151146800-151146822 AAAGGAGGAGGGGTGGGGATGGG - Intronic
964538965 3:157757741-157757763 GACAGAAAAGGGATGGGGGTTGG + Intergenic
965028866 3:163337064-163337086 TTCAGAAGAAGGCTGGGGAAAGG - Intergenic
965693298 3:171380662-171380684 TTGTGAAGAGGGGTGGGGACAGG - Intronic
965816148 3:172638934-172638956 AACAGATGAGGGGAGGGGTTAGG - Intronic
966387192 3:179411707-179411729 TACGGCAAAGAGGTGGGGATGGG + Intronic
966924704 3:184636753-184636775 TAAGGAAGCGGGGTGGGGAGGGG - Intronic
967035792 3:185647472-185647494 TACAGGGTAGGGGTGGGGAGTGG - Intronic
967726328 3:192865710-192865732 CACAGAAGAATGGTGAGGATGGG - Intronic
967860296 3:194146171-194146193 TACACATCTGGGGTGGGGATGGG + Intergenic
968351952 3:198065035-198065057 TACATGAGAGGGATGGTGATGGG + Intergenic
968356391 3:198110847-198110869 AACAGAAGAGAGCTGGGGTTTGG + Intergenic
969329196 4:6463351-6463373 TCCTGAGGAGGGGTGGGGGTGGG + Intronic
969531408 4:7733033-7733055 TCCACCAGAGGGGTGGGGAGAGG - Intronic
969827993 4:9773254-9773276 TAGGGTAGAGGGGAGGGGATGGG - Intronic
970410160 4:15798230-15798252 TCCAGAAGTGGGGTGGTCATAGG + Intronic
971397211 4:26239719-26239741 AAGAGAAGAGGGGAGGGGAGGGG + Intronic
973830600 4:54755489-54755511 TAAAGAAAAGGGGTGGGGCTTGG + Intergenic
974326563 4:60422238-60422260 GACAAAAGAGGGGAGGGGAGAGG + Intergenic
975372793 4:73607837-73607859 TAGAGAGGAGGGGTAGGGAGGGG - Intronic
975372806 4:73607890-73607912 TAGAGAGGAGGGGAGGGGAGGGG - Intronic
975372825 4:73607958-73607980 TAGAGAGGAGGGGAGGGGAGGGG - Intronic
976867801 4:89751694-89751716 TCAAGTGGAGGGGTGGGGATTGG - Intronic
977842425 4:101724759-101724781 TACATGAGAGGGGAGGGGAATGG + Intronic
977861829 4:101970489-101970511 TCCAGGAGAGTGGTGGTGATAGG - Intronic
978413917 4:108455558-108455580 CAGAGAAGAGGACTGGGGATGGG - Intergenic
980249484 4:130296016-130296038 GACAGGAGAGGGGAGGGGAGGGG - Intergenic
980997059 4:139789402-139789424 TTCACAAGAGGGGTGGGTAGAGG + Intronic
983019339 4:162655910-162655932 AACAGAGGAGGGCTGGGGAGTGG - Intergenic
984969412 4:185173723-185173745 TAGAGGATAGGGGTGGGGAAAGG + Intronic
985446811 4:190026554-190026576 AACAGAAGAGAGCTGGGGTTTGG - Intronic
985664982 5:1177352-1177374 TACAGCAAAGGGGTGAGGAACGG - Intergenic
986676799 5:10192986-10193008 AACAGAAGAAGGGTGGGAGTGGG - Intergenic
987849159 5:23326340-23326362 GACAGAAGAGGAGTGGGGAGGGG + Intergenic
988868155 5:35358260-35358282 TACAGATAAGGGGTAGGGAGGGG - Intergenic
988935515 5:36078670-36078692 TGCAGTAGAGGGGTGTGGACGGG - Intergenic
991361327 5:65823878-65823900 TCCAGAAGAGGAGTGGGTTTTGG + Exonic
991513524 5:67407479-67407501 AAGAGAAGAGGGGAGGGGAGGGG - Intergenic
992643902 5:78794560-78794582 CAAAGAAGAGAGGTGGGGTTGGG + Intronic
992658735 5:78936488-78936510 AAAAAAAGAGGGGTGGGGAAGGG + Intronic
993126673 5:83844175-83844197 TGTAGATGTGGGGTGGGGATGGG + Intergenic
993510151 5:88761066-88761088 TGCATAAGAGGAGTCGGGATCGG + Exonic
994100105 5:95882577-95882599 TACCGAGGTGGGGTGGGGGTGGG + Intergenic
995543100 5:113203261-113203283 TGCCCAAGAGGTGTGGGGATGGG + Intronic
997389355 5:133501176-133501198 TACAGCAGACGGCTGGGGAAAGG + Intronic
998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG + Intergenic
998462538 5:142320440-142320462 AAGAGAAGAGGGTTGGGAATCGG - Intronic
999001871 5:147932533-147932555 TACAGCAGAGGAGAGGGGTTAGG + Intergenic
999621947 5:153482657-153482679 GATAGAAGAAGGGTGGGAATGGG + Intergenic
999639526 5:153658227-153658249 CACAGAACAAGGGTGGGGATAGG + Intronic
1000342465 5:160288192-160288214 TACGGAGGAGAGGTCGGGATGGG + Intronic
1001119331 5:168966687-168966709 GACAGAAGAGGAGTAGGCATGGG - Intronic
1002619098 5:180474397-180474419 TATAGTAAAGGAGTGGGGATGGG + Intergenic
1004008443 6:11658127-11658149 TAAAGGTGAGGGGTGGGGGTAGG + Intergenic
1004493008 6:16135064-16135086 TACAGAAGAGGGCTGGGAACAGG - Intronic
1004527421 6:16422367-16422389 TACAGAAGAGGAGAGAGAATGGG - Intronic
1005229257 6:23681341-23681363 TATAGAAGAGGAAGGGGGATGGG - Intergenic
1006180102 6:32149400-32149422 TACGGAGGAGGGGTGGGGGAAGG + Intronic
1006264319 6:32905116-32905138 TAGAGAAGAGAGGTGGGCAGTGG + Intergenic
1007184568 6:39958058-39958080 TGAATAAGAGAGGTGGGGATAGG + Intergenic
1007323919 6:41046062-41046084 TCCAGAGTAGGGGTGGGGGTAGG - Intronic
1007363803 6:41375993-41376015 TACAGAATAGGGTTGGGTCTGGG + Intergenic
1007388631 6:41536722-41536744 TACAGAAGATGGCTTGGGCTGGG + Intergenic
1007591035 6:43021098-43021120 TCAAGCAGAGGGGAGGGGATAGG - Exonic
1007631266 6:43274867-43274889 TCCAAATGAGGGGTGGGGAAGGG + Intronic
1007816711 6:44530193-44530215 AACAGCAGTGGGGTGGGGTTGGG - Intergenic
1008214891 6:48777265-48777287 TGGAGAAGAGGGGTGATGATAGG - Intergenic
1008851520 6:56028053-56028075 TTGAAATGAGGGGTGGGGATGGG + Intergenic
1010180480 6:73081156-73081178 CACAGAAGAGGCTTGGGAATTGG + Intronic
1010413459 6:75587226-75587248 AAGAGAAGAGGGGAGGGGAGGGG - Intergenic
1010472784 6:76249562-76249584 CACAGAAGACGGGTGGGGATGGG + Intergenic
1011030123 6:82913443-82913465 GAGAGAAGAGGGGTTGGGTTAGG - Intronic
1011211466 6:84960196-84960218 GGCAGAAGAGGGGTGGCTATAGG + Intergenic
1011327353 6:86163750-86163772 TAAAGTATAGGGGTGGGGAAAGG + Intergenic
1011632346 6:89339562-89339584 GAGGGAAGAGGGGTGGGGAGGGG + Intronic
1012928828 6:105295552-105295574 GAAAGAGCAGGGGTGGGGATAGG - Intronic
1013112219 6:107073307-107073329 TAGAGGGGAGGGGTGGGGAGTGG - Intronic
1013599600 6:111692019-111692041 TGCAGCAGAGGGGTAGGGAGTGG - Intronic
1013634125 6:112012419-112012441 TACAGGAGAGGGTGGAGGATGGG - Intergenic
1013806411 6:114000715-114000737 CAGAGAACAGGGCTGGGGATGGG - Intronic
1013931592 6:115540871-115540893 TAGAGGACAGGGGTGGGGAGTGG + Intergenic
1013985511 6:116187598-116187620 TACAGCAGAGCAGTGGGGAAAGG + Intronic
1014187974 6:118457588-118457610 AACAGAAGGCGGGTGGGGGTGGG - Intergenic
1014798567 6:125752011-125752033 TAGAGAAAAGGCGTCGGGATCGG + Exonic
1015011090 6:128349222-128349244 TGCAGAAGAGGTGTGAGGAATGG - Intronic
1016444127 6:144115785-144115807 TAGTGAGGAGGAGTGGGGATGGG - Intergenic
1016737838 6:147499581-147499603 TAGAGTAGAGGGTTGGGGACAGG - Intergenic
1018318783 6:162584832-162584854 GACAGGGGAGGGGAGGGGATGGG - Intronic
1018581218 6:165309709-165309731 CACAGAAGAGGGGAGGAGTTGGG - Intergenic
1018670572 6:166173447-166173469 GAGAGGAGAGGGGTGGGGCTTGG + Intergenic
1019894828 7:3975739-3975761 GACAGAACAGGAGTTGGGATGGG - Intronic
1019923045 7:4174883-4174905 AACAGAGGAGGGGTGGGAACGGG - Intronic
1020535392 7:9389827-9389849 TAGAGATGGGGGGTGGGGATGGG + Intergenic
1022082678 7:27038242-27038264 AAAAGAAGAGGGGTGGGGCATGG + Intergenic
1024204546 7:47145737-47145759 AACACAGGAGGGGTGGGGAGTGG + Intergenic
1026314047 7:69212470-69212492 CACAGATAAGGGGTGGGGGTGGG - Intergenic
1027195514 7:76027320-76027342 AATGGAAGAGGGGAGGGGATGGG + Intronic
1027197059 7:76037852-76037874 ACCAGAACAGCGGTGGGGATTGG - Intronic
1027228395 7:76259124-76259146 GAGAAAGGAGGGGTGGGGATGGG + Intronic
1027627730 7:80565249-80565271 TGGAGAAGACTGGTGGGGATAGG + Intronic
1029264654 7:99328651-99328673 TAAAGAAAAGGGGTGGGGGCCGG + Intronic
1031483614 7:122304943-122304965 AGCAAAAGGGGGGTGGGGATGGG - Intronic
1031945577 7:127836187-127836209 GACAGAGGAGTGGTTGGGATAGG + Intronic
1031965328 7:128023737-128023759 TCAAGAATAGGGGTGGTGATGGG + Intronic
1032199298 7:129808126-129808148 TAGAGAAGAGGGAAGGGGAGGGG - Intergenic
1034652378 7:152701691-152701713 GACTGAAGAAGGGTGGGGAATGG - Intergenic
1034926962 7:155130128-155130150 CAGAGAAGGGTGGTGGGGATAGG + Intergenic
1034997023 7:155584064-155584086 TCCAGAAGAGGGAGGAGGATGGG - Intergenic
1035413110 7:158661448-158661470 CAGAGAAGAGTGGTGGGGGTGGG + Intronic
1035699109 8:1624665-1624687 CACAGAGGAGGGGAGGGGACAGG + Intronic
1035830677 8:2691366-2691388 TTCAGAAAGAGGGTGGGGATTGG - Intergenic
1036211459 8:6844358-6844380 TACAGAAGAGGGCTCGGCCTGGG - Intergenic
1037583607 8:20261539-20261561 TGCAGAAGGGGGCTGGGGATGGG - Intronic
1037911886 8:22748554-22748576 TACAGAAGAATGCTGGGGAGGGG - Intronic
1039003459 8:33007627-33007649 TATAGAAGATGGGTGAGGATGGG - Intergenic
1040470484 8:47732108-47732130 CTCTAAAGAGGGGTGGGGATTGG - Intronic
1041215422 8:55595679-55595701 TTCCCAAGAGGGGTGTGGATTGG - Intergenic
1041992927 8:64016072-64016094 TATAGAAGAGGGGTGAGGTAGGG + Intergenic
1042712507 8:71734049-71734071 TTCAGAAGGGGGGTGGGGTTGGG - Intergenic
1042778674 8:72465889-72465911 TACAGAAGAGAGCAGGGGAAGGG - Intergenic
1043044171 8:75300365-75300387 GAGAGAAGAGGGGAGGGGAGAGG + Intergenic
1043293585 8:78636138-78636160 GAGAGAGGAGGGGAGGGGATGGG + Intergenic
1043429166 8:80178024-80178046 TGCAGAATAGGGAAGGGGATGGG - Intronic
1044153775 8:88817188-88817210 TTCAGAAAAGGGGAGGGGAGGGG - Intergenic
1044623776 8:94216760-94216782 TAAAGAAGAGGAGTGGAGTTTGG - Intronic
1044830852 8:96246958-96246980 AATAGAAGAGGGGAGGGGAGGGG - Intronic
1045578627 8:103453673-103453695 CAGAGAAGAGGGCTGGGAATGGG - Intergenic
1046830563 8:118741409-118741431 TGCCGAAGAGTGGTGGGGCTGGG + Intergenic
1046891825 8:119430536-119430558 TGAAGAAGTAGGGTGGGGATTGG - Intergenic
1048082672 8:131146125-131146147 AACAGATGAGGGGTGGGGAGAGG + Intergenic
1048104033 8:131387914-131387936 TCCAGAAGAGGAGGGGAGATTGG - Intergenic
1048195910 8:132331561-132331583 AAGAGAAGAGGGGAGGGGACAGG - Intronic
1048267187 8:132998133-132998155 TACAGAAGAAGGGTGTCCATTGG - Intronic
1049641566 8:143718326-143718348 GACAGAACAGAGGTGGGGCTGGG - Intronic
1049654767 8:143792677-143792699 CACGGAAGTGGGGTGGGGGTTGG - Intronic
1049745784 8:144262771-144262793 TGCAGGTGAGGGGTGGGGGTAGG - Intronic
1050722975 9:8611962-8611984 AACAAAAGAGGGGAGGGGAGGGG + Intronic
1051717303 9:19998602-19998624 TGGAGAAGAGGGGTGGTCATAGG - Intergenic
1051809105 9:21030576-21030598 TTCTGAAGGGGGGTAGGGATGGG + Intronic
1051980935 9:23015522-23015544 TACAGAAGAGTATTTGGGATGGG - Intergenic
1053069562 9:35093066-35093088 TAAAGCAGAGGAGTGGGGCTGGG + Exonic
1053476415 9:38385163-38385185 GACAGTAGAAGGGTGAGGATGGG - Intergenic
1056137759 9:83646613-83646635 GAAAGAAGAGGGGAGGGGAGAGG + Intergenic
1056413278 9:86353719-86353741 TCCAGAATAGGGGTGGTGAAGGG - Intronic
1056477741 9:86969197-86969219 TACAGAAGAGGGGAGAGAAGGGG - Intergenic
1057200401 9:93136797-93136819 CACAGAGGAGGGGTGTGGCTGGG + Intergenic
1057314744 9:93961012-93961034 GAAAGAAGAGGGGTGGGGGGAGG - Intergenic
1057633057 9:96736341-96736363 GACAGGAGAGGGGAGGGGAGGGG - Intergenic
1058200041 9:102027928-102027950 TATAGAACATGGATGGGGATGGG + Intergenic
1058608609 9:106750889-106750911 CCCAGAAGAGGGGTGGAAATGGG - Intergenic
1058661897 9:107274174-107274196 TGGTGAAGAGGGCTGGGGATTGG + Intergenic
1058856525 9:109068005-109068027 TTCAGCAGATAGGTGGGGATGGG - Intronic
1058945997 9:109856971-109856993 CACAGAACAGGGGAGGGGATGGG - Intronic
1059419233 9:114180816-114180838 TACTGGAGAGGGTTGGGGACGGG + Intronic
1060408134 9:123382683-123382705 CACAGAAGTGGTGTGGGAATGGG - Intronic
1061904935 9:133691940-133691962 TAGAGCTGAGGGCTGGGGATCGG - Intronic
1062002343 9:134222784-134222806 GAGAGAAGAGGGGAGGGGAAGGG - Intergenic
1062586737 9:137252979-137253001 GAGAGAAGAGGGCTAGGGATGGG + Intronic
1186141102 X:6574867-6574889 GACACAAGAGGGGTGGGTTTGGG + Intergenic
1187188304 X:17009111-17009133 TAGAGAAGAGAGGAGGGGCTAGG - Intronic
1187317128 X:18206671-18206693 GTCAGAAGAAGGGCGGGGATGGG + Intronic
1187737821 X:22322478-22322500 AACAGAAGAGGGCTGGGAAAAGG - Intergenic
1188025362 X:25202599-25202621 TAAAGAAGAGAGGTGGGATTTGG + Intergenic
1188661043 X:32758955-32758977 TAGAGAAGAGGGATGGGCATAGG - Intronic
1189603351 X:42650405-42650427 TAAAGTAAAGGGGTGGGGAAAGG + Intergenic
1189992350 X:46607277-46607299 TTCAGATGAGGAGTTGGGATTGG - Intronic
1190247446 X:48699969-48699991 TCCAGAAAAGGGGTGGGGTGGGG + Intronic
1194311893 X:92320792-92320814 TAAAGAAGAGGGATTGGGGTAGG + Intronic
1197637201 X:128928451-128928473 TACTTTAGAGGTGTGGGGATGGG - Intergenic
1197917365 X:131550918-131550940 CAGAGAAGAGGGGTTGGGTTGGG - Intergenic
1198486793 X:137095344-137095366 TCCAGGAGAGGCCTGGGGATTGG + Intergenic
1201470353 Y:14326531-14326553 TACAGAAAAAAGGTGTGGATTGG + Intergenic