ID: 1165473247

View in Genome Browser
Species Human (GRCh38)
Location 19:36015255-36015277
Sequence CTGTAGGACTTGAGGGCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165473239_1165473247 10 Left 1165473239 19:36015222-36015244 CCTAGGAGTTACGGCATTGGGGT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1165473247 19:36015255-36015277 CTGTAGGACTTGAGGGCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 172
1165473234_1165473247 25 Left 1165473234 19:36015207-36015229 CCATGATTTGGGGGTCCTAGGAG 0: 1
1: 0
2: 1
3: 11
4: 231
Right 1165473247 19:36015255-36015277 CTGTAGGACTTGAGGGCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165473247 Original CRISPR CTGTAGGACTTGAGGGCACA GGG Exonic
900657856 1:3768839-3768861 CTGGAGGTCGTGAGGTCACAAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907651886 1:56303043-56303065 CTGTAGGCAATGAGGGGACACGG - Intergenic
908559662 1:65292954-65292976 CTGTAGGATGGGAGGCCACATGG - Intronic
909172730 1:72316406-72316428 ATCAAGGACTTGAGGACACAGGG - Intergenic
909369755 1:74870241-74870263 CTGTAGGAGTGGAGCCCACATGG + Intergenic
912952729 1:114131577-114131599 CTTGGGGACTTGGGGGCACAGGG + Intronic
914900938 1:151710695-151710717 CTGGAGGACTTCCGTGCACAGGG - Intronic
917263417 1:173194451-173194473 CTGTAGGCTTTGACAGCACAAGG + Intronic
918271882 1:182909687-182909709 CAGCAGGACTTGAGTACACACGG + Intronic
919796712 1:201325366-201325388 CTGGGGGACTCGGGGGCACAAGG + Intronic
921407115 1:214792177-214792199 CTGGAGCACTTTGGGGCACATGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
924030203 1:239878698-239878720 TTGTCGGACATGAGGGCAAAGGG + Intronic
1063597874 10:7453561-7453583 CCATAAGACTTGGGGGCACAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1069643044 10:69968601-69968623 CTGGAGGCCTTGGGGGCAGAGGG - Intergenic
1074428687 10:113374434-113374456 CTGTAGGACTTGTGATCATAAGG + Intergenic
1074452645 10:113571671-113571693 CTGTGGAACTTGAGGGCGCCAGG + Intronic
1074706033 10:116132777-116132799 CTCAATGACTTGAGGGCACAGGG + Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075515403 10:123104281-123104303 TGGTAGGACCGGAGGGCACAAGG + Intergenic
1077355778 11:2116083-2116105 CAGGAGGACTTGGGGGCACTGGG + Intergenic
1077402603 11:2366578-2366600 CTGTTGGACGTGGGGGCACTGGG - Intergenic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1080793100 11:35538674-35538696 CTGTGACTCTTGAGGGCACAAGG - Intergenic
1081028968 11:38053313-38053335 CTGTGGAACTTGAGGGCTAAGGG + Intergenic
1083177592 11:60961041-60961063 CTGAGAGACTTGAGGGCAGAAGG + Intergenic
1084205047 11:67586324-67586346 CTGGAGGAATTGGGGGCAGAGGG - Intronic
1084230004 11:67744717-67744739 CTGTGGGCTTTGGGGGCACAGGG - Intergenic
1085156024 11:74295066-74295088 CTTTAAGATTTGAGGGCACGGGG - Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1088195181 11:107265983-107266005 CTGAAGGACTTGTGGACACCTGG - Intergenic
1088285849 11:108186732-108186754 CTGTAGGACTTGAGTACATGTGG - Intronic
1096904652 12:54924107-54924129 CTGTAGGACTTGAGCATCCATGG - Intergenic
1097549201 12:61046051-61046073 CTGTAGAACTTGAGGTCAATGGG + Intergenic
1099060167 12:77897955-77897977 CTGGATGACTTTAGGTCACAAGG + Intronic
1099520820 12:83659327-83659349 CTGTAGTACTTGTGGTAACATGG + Intergenic
1099661556 12:85569404-85569426 CTGTTCTACTTGAGGTCACATGG - Intergenic
1100584522 12:95967418-95967440 CTGGAGGACTTGAGGTCCAAGGG - Intronic
1102497668 12:113330530-113330552 GGGGAGGACTTGTGGGCACAAGG + Intronic
1104961170 12:132489445-132489467 TTGTGGGACTTGGGGGCACGTGG + Intergenic
1107039798 13:35936746-35936768 CTGATGGATTTGAGGGCACAAGG + Intronic
1108450520 13:50558187-50558209 CTATAGGAGTTGAGAGCAGAGGG + Intronic
1110603502 13:77403775-77403797 CTGTGGAACTTGGGGGCAAAGGG - Intergenic
1110615469 13:77536785-77536807 CTGTAGTACTTGAGTTCTCATGG + Intronic
1112621011 13:101053560-101053582 TTGTAGGCTTAGAGGGCACAGGG + Intergenic
1113297334 13:108973559-108973581 CAGTCGGACTTGGGGACACAGGG - Intronic
1114182501 14:20378220-20378242 GTGTAGGACCTGGGGGCACCCGG - Exonic
1114245205 14:20906362-20906384 CTGTCTGCCTTGAGGGCACCAGG + Intergenic
1118135116 14:63015689-63015711 CTGCAGGACTTGAGTGTGCACGG - Intronic
1121841710 14:97139850-97139872 CTGTAGGCCTTCAAGGCCCAGGG + Intergenic
1124046698 15:26157040-26157062 CTGTGGAACTTCAGAGCACAGGG - Intergenic
1126892552 15:53222108-53222130 CTGTAGCACTTGAGGTGACAGGG + Intergenic
1128133545 15:65246357-65246379 CCAGAGGCCTTGAGGGCACAGGG + Intronic
1130897626 15:88183380-88183402 CTGCAGGGATTGGGGGCACATGG - Intronic
1131290545 15:91103004-91103026 CAGTAGGACCTGAGGTCATAGGG + Intronic
1133145938 16:3786685-3786707 CTGTAGGGCTTGAGTCCACCTGG + Intronic
1137446828 16:48537026-48537048 CTGTCAGTCTTCAGGGCACAGGG - Intergenic
1137902366 16:52282621-52282643 CTGTATGACTTTAAGGTACAAGG - Intergenic
1139662346 16:68429731-68429753 ATGAAGGACTTGAGGACAAAGGG + Intronic
1142020779 16:87780883-87780905 GTGAAGGACTTGTGGGCAGAGGG - Intergenic
1143130989 17:4676753-4676775 CTGTTGGAGCTGAGGGCTCAAGG + Exonic
1143455601 17:7065612-7065634 CTGCAGGACTTGGGGGAACATGG + Intergenic
1143771795 17:9173704-9173726 CTGTAGGACTTGGAGTCACATGG + Intronic
1147466778 17:40616668-40616690 CTGTAGGACCTGGGTACACAGGG + Intergenic
1148579812 17:48735789-48735811 GTTTAGGACTTGAGGGGCCAGGG - Intergenic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1148947421 17:51276312-51276334 CTGTATGACTTCAGTGTACAAGG + Intronic
1150344691 17:64395238-64395260 CTTTGGAACTTGAGGGCACGGGG - Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152013606 17:77735595-77735617 CTGCAGGACTGGAGGGGCCAGGG - Intergenic
1155275815 18:24186503-24186525 CTCTAGGAGTTGGGGGCATATGG + Intronic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1161276847 19:3423267-3423289 CTGAAGCACTTGAGGGCATTTGG - Intronic
1163458356 19:17422007-17422029 CTATAGGATTAGAGGGCTCATGG + Intronic
1164760987 19:30728075-30728097 CTGTGGAACATGAGGTCACATGG + Intergenic
1165358093 19:35316450-35316472 CTGTGTGACTTAAGGTCACAGGG + Intergenic
1165419255 19:35714953-35714975 CTGGAGGGCTCGAGGGGACAGGG + Exonic
1165473247 19:36015255-36015277 CTGTAGGACTTGAGGGCACAGGG + Exonic
1166597717 19:44065004-44065026 ATGTAGGTCTTTAGGTCACAGGG - Intronic
1167498361 19:49831862-49831884 GGGTAGGACATGAGGGCTCAAGG + Intronic
925164372 2:1706298-1706320 CTGGAGGACTTGATATCACATGG - Intronic
925166593 2:1719418-1719440 CTGTGTGCCTTGAGGGTACATGG + Intronic
925636114 2:5942614-5942636 GTGTAGGACTTGGGGTCAGATGG + Intergenic
925900021 2:8502608-8502630 CTTGAGGACTGGAGGGCCCACGG - Intergenic
926477007 2:13336250-13336272 CTGAAGGACTTGAGGATACCTGG + Intergenic
928959800 2:36912407-36912429 CTGTAGGACTTTGTGACACATGG - Intronic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932838364 2:75058754-75058776 CTGCAGGATTTGAGGCTACATGG - Intronic
934685104 2:96315425-96315447 CTGTGGGACTTGAGAGAGCAAGG + Intergenic
937089610 2:119197095-119197117 CTGAAGGATTTGCGGGGACAGGG - Intergenic
938707095 2:133941681-133941703 CTGTGGGACTTGGGGGCATGAGG - Intergenic
939940137 2:148339377-148339399 TTGAAGGACTTGAGGGCAAAGGG - Intronic
940736626 2:157460792-157460814 CTGAAGGACTTGGGTGCAGAGGG + Intronic
943702099 2:190997412-190997434 CTGTAGGACCTGGGCACACAAGG - Intronic
945708884 2:213271339-213271361 CTGTAAGACTCCAGGGCAAAGGG - Intergenic
948491299 2:238314987-238315009 GTGGAGGCCTTGAGGGCACAGGG - Intergenic
948931521 2:241135334-241135356 CTGTGGGACTTGAGGGTGCTCGG - Intronic
1170807731 20:19647543-19647565 ATGCTGGACTTGAGGCCACAGGG - Intronic
1172760554 20:37318306-37318328 CAGCAGGACTTGAGACCACAGGG + Intergenic
1172850106 20:37955623-37955645 CTGGAGAATTTGAGGGGACACGG + Intergenic
1174668018 20:52278415-52278437 CCATGAGACTTGAGGGCACAAGG + Intergenic
1176061101 20:63173337-63173359 CTGGAGGAGTCGAGGCCACAAGG + Intergenic
1178566122 21:33687518-33687540 CTGTAGAACTTGAAGGCCTAAGG + Intronic
1178822007 21:35983866-35983888 CTGTGGGACTTGAGGGGCAAGGG + Intronic
1180679183 22:17612551-17612573 CAGTAGTACATGAGGGTACAGGG - Intronic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181748556 22:24973074-24973096 CTGGAAGACCTGAAGGCACAGGG + Intronic
1183121835 22:35736168-35736190 CTGTGGGACTCGGGGGCTCATGG - Intergenic
1183623831 22:38989886-38989908 CTGTGGGATTTGAGGACTCAGGG + Intronic
950982823 3:17327447-17327469 CTGTAGGAAATGAGGTCAAAGGG - Intronic
952732454 3:36653193-36653215 CTTTAGGACTGCAGGACACATGG + Intergenic
953662784 3:44903214-44903236 CTGTAGGACTTGAGTGTGTATGG + Intronic
954182004 3:48888631-48888653 CTGTAGGACTTGGGTGCAGAAGG - Intronic
954305021 3:49721083-49721105 TTGCAGGACTTGTGGCCACAGGG - Exonic
958182647 3:90080518-90080540 CTATAAAACTTCAGGGCACAAGG + Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961383389 3:126510218-126510240 CTGGAGGCCTTGTGGGAACATGG - Intronic
961978547 3:131052766-131052788 CTGTAGGGCTTTAGGTCAGAGGG - Intronic
962200005 3:133393179-133393201 CTGAAGGAATTGAGGGTTCAAGG - Intronic
965826127 3:172731985-172732007 CTGTACAACTGGAGTGCACAAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969386029 4:6848966-6848988 CTGGAGCATTTGAGGACACACGG + Intronic
970584721 4:17504173-17504195 CTGGAGGACGTGAGGGGACGGGG - Intronic
971496452 4:27271106-27271128 CTGTAGGAGTTGAAGACACAAGG - Intergenic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
974243432 4:59282511-59282533 CTCTAGGACGGCAGGGCACAAGG + Intergenic
974884531 4:67802327-67802349 CTGTAGGACAGGTGGGCTCAAGG - Intergenic
977745818 4:100545938-100545960 CTGTTGGACTTGTGGTCTCATGG + Intronic
977760655 4:100732717-100732739 CTGGAGGAAGTGAGGGCAAAGGG + Intronic
978219204 4:106249455-106249477 CTGTGGAACTTGAGTACACATGG + Intronic
980467274 4:133202367-133202389 CTCGAGGTCTTGAGGGTACATGG + Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
987967662 5:24896535-24896557 CAGTAGGTCCTGAAGGCACAAGG + Intergenic
990952061 5:61308226-61308248 CTCTAGGACTTGTGGGCCCAGGG + Intergenic
991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG + Intergenic
995629475 5:114117763-114117785 CTGCATGACATGAGGGCTCAAGG - Intergenic
995684491 5:114757383-114757405 TTGTGAGACTTGAGGGCCCAGGG + Intergenic
998137488 5:139681870-139681892 ATGAAGGGCTTAAGGGCACAGGG - Intronic
999794019 5:154970951-154970973 CTGCAGGACTAGAGACCACATGG + Intergenic
1000942829 5:167383430-167383452 CTGTGGGACTTGAGAAAACATGG - Intronic
1001779982 5:174359999-174360021 CAGTACGATTTGAGGGCAGAGGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1007482111 6:42157003-42157025 CTGGAGGATTTGAGAGGACAGGG + Intronic
1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG + Intergenic
1009280244 6:61741002-61741024 CTCTAGGAAATGAGGGCACAAGG + Intronic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1015018237 6:128440122-128440144 CTGTAGGACTTGAGTATACATGG + Intronic
1018543502 6:164910431-164910453 CTGTAGGACCTCAGTGGACATGG + Intergenic
1018638574 6:165886272-165886294 CTGCAGGACTCCAGGGCCCAGGG - Intronic
1021495886 7:21274270-21274292 CTGTAGGCTTTGTGAGCACAGGG - Intergenic
1028786558 7:94801139-94801161 CTGCAGGATTTGGGGGCAAAAGG - Intergenic
1030941915 7:115660965-115660987 CTGCAGGACTTGAGGATACCCGG - Intergenic
1031584367 7:123517028-123517050 CTCTGGGATTTGGGGGCACAGGG - Intronic
1041448752 8:57984452-57984474 TTGTAAGACTTCAAGGCACAGGG + Intergenic
1041484444 8:58359092-58359114 CTGTAGGAGCTTAGGCCACAGGG - Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1045140949 8:99281588-99281610 CTGTGAGACTTGTGGGCAAAGGG + Intronic
1045174028 8:99700819-99700841 CTGTAAAATTTCAGGGCACAGGG + Intronic
1045795801 8:106042405-106042427 CTTTGGGACTTGAGGGCATATGG + Intergenic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1046760980 8:118020217-118020239 CTGTAGGAACTGAGGCCAGATGG - Intronic
1048066376 8:130973443-130973465 CTGGAGGATGAGAGGGCACATGG + Intronic
1048998907 8:139812024-139812046 CTGGAGGACATCAGGCCACATGG + Intronic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049400965 8:142427056-142427078 CTGGAGGAATGGAGGCCACATGG - Intergenic
1050095788 9:2064726-2064748 TTGTAGGAGTTGGGGGAACAGGG - Intronic
1050592221 9:7172777-7172799 CTTTAGGACTTGAAAACACACGG - Intergenic
1055039600 9:71855036-71855058 CTGTACCACTTCAGTGCACACGG - Intergenic
1056126855 9:83543294-83543316 CTGAAGGACTTGGGGTCCCATGG + Intergenic
1059012255 9:110474598-110474620 CGGTAGGTTTTGGGGGCACAAGG - Intronic
1059972367 9:119680906-119680928 ATGCAGGACTTGAGGCCACTTGG + Intergenic
1060024637 9:120160933-120160955 GTGCAGGGCTTCAGGGCACAGGG - Intergenic
1061235588 9:129341143-129341165 CTGTGGGACTGGAGAGCCCAGGG - Intergenic
1187161209 X:16766931-16766953 ATGTAGCCCTTGAGGGTACAGGG + Intergenic
1188670236 X:32873139-32873161 CTGTAGGTCCTCAGGACACATGG + Intronic
1191896073 X:65994749-65994771 ATGTCAGACTTGAGAGCACAGGG + Intergenic
1192321940 X:70096978-70097000 CTCTAGGACATCAGGACACATGG - Intergenic
1192322136 X:70098572-70098594 CTCTAGGACATCAGGACACATGG - Intergenic
1195900354 X:109791083-109791105 CTGTGGAACTTGAGGGCAACGGG - Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197705111 X:129629349-129629371 CTGTGGGACTTGAGTATACATGG + Intergenic
1201905824 Y:19084809-19084831 TTGTATGGCTTGATGGCACAAGG - Intergenic