ID: 1165473598

View in Genome Browser
Species Human (GRCh38)
Location 19:36017103-36017125
Sequence CAAGAGGCCCAGATGGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165473598 Original CRISPR CAAGAGGCCCAGATGGGTAT TGG (reversed) Intronic
900394850 1:2449047-2449069 GAGGAGGCTCAGATGGGTCTGGG + Intronic
902091730 1:13909076-13909098 CAAGAGGAGAAGATGGGCATTGG + Intergenic
902873298 1:19326835-19326857 CAAGAGGCCCATGTGTGTCTTGG + Intronic
903213696 1:21831854-21831876 CTAGGGGCCCAGTTGGGTAGAGG + Intronic
907237329 1:53061668-53061690 GAAGAGGCCCAGCAGGGTCTTGG + Intergenic
912855815 1:113168088-113168110 CAAGAGACCAAGATGGGTGCTGG - Intergenic
915296552 1:154925447-154925469 TGAGAGGCCCAGGTGGCTATGGG - Intronic
918017959 1:180656097-180656119 CCAGGGGCTCAGAAGGGTATTGG - Intronic
921094452 1:211874604-211874626 CTAGAGTTCCAGATGGGTGTGGG - Intergenic
921794473 1:219326527-219326549 CAAGAATCCCAGAAGGGAATTGG - Intergenic
1067470227 10:46531482-46531504 AAAGAGGCTCAGATGGATTTGGG - Intergenic
1067563238 10:47318777-47318799 CAAGAACCCCAGAAGGGTCTAGG - Intergenic
1069832809 10:71291445-71291467 CAGGAGGCACAGAGGGGTGTAGG - Exonic
1073204866 10:101763449-101763471 CAAGAGATCCAGATGGGGAAGGG + Intergenic
1076028723 10:127140088-127140110 CAACAGCCCCAGATTGGTTTTGG + Intronic
1076632255 10:131858176-131858198 CCTGAGGACCAGATGGGGATGGG - Intergenic
1079961671 11:26931913-26931935 GAAGAGGGCAAGAAGGGTATGGG + Intergenic
1080311640 11:30900372-30900394 CAAGACACCCAGATGGCAATAGG + Intronic
1081459473 11:43258617-43258639 CCAGAGGCCAAGAAGGGGATGGG + Intergenic
1083505489 11:63153416-63153438 CCAGAGGCTTAGAAGGGTATGGG - Intronic
1083506099 11:63158904-63158926 CCAGAGGCTGAGAAGGGTATTGG - Intronic
1085476901 11:76794721-76794743 CCAGATTCCCAGATGGGTTTTGG - Intronic
1087303007 11:96457472-96457494 CAAGAGGCAATGAGGGGTATAGG - Intronic
1087826763 11:102773396-102773418 CAAGAAGCACAGATTGGAATTGG - Intronic
1088963335 11:114692547-114692569 CATGAGGCCCAAATGGGTTGAGG + Intronic
1090976879 11:131686758-131686780 CGAGAGGCACAGATCGGAATGGG + Intronic
1096562960 12:52450253-52450275 CAAGAACCACAGATGGTTATGGG - Intronic
1096565112 12:52471913-52471935 CAAGAACCACAGATGGTTATGGG - Intronic
1096567127 12:52491353-52491375 CAAGAACCACAGATGGTTATGGG - Intronic
1098498789 12:71166521-71166543 CAAGAGTTCCGGATGGGTGTGGG - Intronic
1101630844 12:106492933-106492955 CAGGAGGGCCAAATGGGAATTGG - Intronic
1103172186 12:118830953-118830975 CAAGAAGGCCAGATGAGTGTGGG - Intergenic
1103474028 12:121205161-121205183 GAAGAGGCCCAAGTGGGCATGGG + Intergenic
1104072382 12:125356873-125356895 CAAGAGGCCCAGTGGGGCAGGGG - Intronic
1105379490 13:19873847-19873869 TGGGAGGCCCAGATGAGTATGGG - Intergenic
1108942961 13:55980549-55980571 CAAGAGGCTGAGAAGGGTAGTGG - Intergenic
1112639800 13:101260024-101260046 CCAGAGGCTGAGATGGGTACTGG - Intronic
1113364241 13:109661638-109661660 CAAGAGCCCGAGCTGGGCATTGG + Intergenic
1113711344 13:112467290-112467312 CAGGAGCCCCAGGTGGGGATTGG + Intergenic
1118809479 14:69262368-69262390 CAAGAGTCCCAGAATGGTGTAGG + Intronic
1118896795 14:69952192-69952214 TCAGAGGCACAGATGGGTTTGGG - Exonic
1120992508 14:90390296-90390318 CAATAGGCCCATATGGCTAGTGG - Intergenic
1121334909 14:93071309-93071331 CCAGAGGCCCTGATGGGGCTGGG - Intronic
1122087350 14:99316989-99317011 AAAGGGGCCCAGAGGGGTAGTGG + Intergenic
1126067466 15:44837158-44837180 CAGGAGGCCCAGATGTGGAAGGG - Intergenic
1126092411 15:45063723-45063745 CAGGAGGCCCAGATGTGGAAGGG + Intronic
1126522538 15:49612994-49613016 CCAGAGGCCGAGAAGGGTAGTGG + Intronic
1126921909 15:53536075-53536097 CAAGAGGCACAGCTGGGACTTGG + Intronic
1129304953 15:74653204-74653226 CATGAGGCCCAGAGAGGTAAAGG - Intronic
1129325767 15:74799534-74799556 CCAGGGCCCCAGATGGGTTTAGG - Intronic
1131193588 15:90337087-90337109 GAAGAGGCCCAGGTGGGGAGGGG + Intergenic
1131985832 15:98042184-98042206 CAGGAAGGACAGATGGGTATGGG - Intergenic
1132721459 16:1318366-1318388 CCAGAGGCACAGATGGGTGCCGG + Intronic
1142863576 17:2777488-2777510 CCAGAGGCCTGGATGGGTGTGGG + Intronic
1143670167 17:8391505-8391527 CAAATTGCCCAGAGGGGTATAGG + Exonic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1147458774 17:40555187-40555209 CAGGTGGCCCAGATGGTGATCGG - Exonic
1147936053 17:44011896-44011918 CAAGAGGCTGAGATGGGCACAGG - Exonic
1148476929 17:47934875-47934897 CATGAGCCCCTGATGGGTCTGGG - Intergenic
1150847181 17:68671185-68671207 CAAAATTCCCAGATGTGTATGGG + Intergenic
1152540583 17:80972393-80972415 GCAGAGGCCCAGGTGGGCATGGG + Intergenic
1158521128 18:58172036-58172058 CATGAGGCCCAGCTGGGATTGGG + Intronic
1159601212 18:70430424-70430446 CAGGAGGCCCAGCTTGGTAATGG - Intergenic
1160010809 18:75105984-75106006 CTAGAGTCCCAGTTGGGGATAGG - Intergenic
1160782491 19:884033-884055 CAAGAGGCCCCGATGGCTCCCGG - Intronic
1161288262 19:3479682-3479704 GAAGAGGCTCAGATGGGGAGGGG + Intronic
1164299889 19:23952568-23952590 TAAGATGGCCAGATGGCTATTGG - Intergenic
1165473598 19:36017103-36017125 CAAGAGGCCCAGATGGGTATTGG - Intronic
1167919308 19:52769588-52769610 CAAGATGCAGAGATGGGTAGTGG - Intronic
926321158 2:11749198-11749220 GAAGAGGCCCAGGTGCCTATCGG + Intronic
929732605 2:44511712-44511734 CAAGAGCCCCAGATGGTTTTAGG - Intronic
932343055 2:70978804-70978826 CAAGCAGCCCAGGTGGGTAGCGG + Exonic
933785451 2:85837421-85837443 CCAGAGGCCAAGAAGGGTAGGGG + Intergenic
934656358 2:96118450-96118472 CTAGAGGCCCACATGGGCATCGG + Intergenic
936489265 2:112956508-112956530 CAAGGGGCCCAGGAGGGTTTGGG - Intergenic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
946820131 2:223620585-223620607 CAAGAGGCAGAGATGGGGAAGGG - Intergenic
947429819 2:230017404-230017426 CAAGAGGACAAAATGGGGATAGG + Intergenic
1169773235 20:9224213-9224235 CAAGAGAGCAAGATGGGTACAGG - Intronic
1169794037 20:9442247-9442269 CAAGAGCCACAGATGGCTAGAGG + Intronic
1171087875 20:22255074-22255096 AAAGAGTCCCAGAGGGGGATTGG - Intergenic
1171976153 20:31596022-31596044 GAAGGGGCCCAGTTGGGTAGTGG + Intergenic
1174560894 20:51429962-51429984 CAGGAGGCCCAAAAGGGTCTCGG + Intronic
1178213770 21:30569445-30569467 CCAGAAGCCCAAATGGGCATGGG - Intergenic
1181108498 22:20588271-20588293 CAAGAAGCCCCACTGGGTATAGG - Intergenic
1182527176 22:30927719-30927741 CATGACGCCCAGATGGGATTGGG - Intronic
1182547863 22:31085993-31086015 AAAGAGGCCCAGAGGGGCAAGGG - Intronic
1184411794 22:44330429-44330451 CAGGAGGCCCAGAGAGGTAGGGG + Intergenic
1184776473 22:46625980-46626002 CAGGAGGCCCAGCTGGCCATGGG + Intronic
950552117 3:13672827-13672849 GAAGAGGGGGAGATGGGTATCGG - Intergenic
953629591 3:44601915-44601937 CAAGAAGCCCAGATGCTTACAGG + Intronic
954794142 3:53153023-53153045 CAGGGGGCCCAGGTGGGTGTAGG - Intergenic
957421068 3:79970808-79970830 CCAGAGGCTGAGATGGGTACTGG + Intergenic
958756292 3:98253182-98253204 CCAGAGGCTGAGAAGGGTATTGG - Intergenic
960087915 3:113610594-113610616 AATGAGCCCCAGATGGGTGTGGG - Intronic
960416060 3:117386319-117386341 CTAGAGGCTGAGATGGGTAGAGG + Intergenic
960589722 3:119353854-119353876 CAAGAAGCCAAGAAGGGAATGGG - Intronic
961096355 3:124159857-124159879 CTAGAGGTACTGATGGGTATGGG + Intronic
961315531 3:126032890-126032912 AGAGAGGCCCAGAAGGGTCTAGG + Intronic
965903721 3:173676307-173676329 CAACAGGGCCAGATGGAAATTGG + Intronic
967208695 3:187147806-187147828 TAACAGGCCCTGATGGGTACCGG + Intronic
967524844 3:190479604-190479626 CAAGAGGCCTGGAAGGGTAGCGG + Intergenic
969590221 4:8117804-8117826 AGAGAGGCCCACATGGGAATTGG - Intronic
970915127 4:21323412-21323434 CAAGAGTCCAAGAAGGGTACTGG - Intronic
974946816 4:68538447-68538469 CAGGAGTTCCAGATGAGTATGGG - Intronic
975914980 4:79313819-79313841 CAAGATGCCCAGATGGTGATGGG + Intronic
978496894 4:109368939-109368961 CAAGAGGGACAGGTGGATATTGG - Intergenic
980595811 4:134952863-134952885 CAAGCGGCCCAGATTGGTGACGG + Intergenic
984751504 4:183280876-183280898 CAAGGGGCCCAGATGGAGACTGG + Exonic
985572322 5:654843-654865 CTAGAGTCCCAGATGGGGACAGG - Intronic
989428670 5:41326612-41326634 CAATTGGCCAAGAAGGGTATTGG - Intronic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
994274290 5:97816552-97816574 CCAGAGGCTGAGAAGGGTATTGG - Intergenic
998063231 5:139135525-139135547 CCACAGGCCCAGCTGGGAATAGG + Intronic
998646499 5:144067790-144067812 CAAGAGGCCCTGTTGGGTCAGGG - Intergenic
999114408 5:149149909-149149931 CCAGAGACCCAGCTGGCTATGGG + Intronic
1000147804 5:158470248-158470270 ACTGAGGCCCAGATGGGGATGGG - Intergenic
1001791360 5:174460143-174460165 GGAGAGGCCCAGATGTGTCTGGG - Intergenic
1003346459 6:5272813-5272835 CCAGAGGCCAAGAAGGGTACAGG - Intronic
1003588070 6:7411508-7411530 TAAAAGGCCCAGATAGGTTTGGG - Intronic
1003615492 6:7651607-7651629 CAAGTTTCCCAGATAGGTATGGG + Intergenic
1004098151 6:12579990-12580012 TAAGAAGGGCAGATGGGTATGGG + Intergenic
1006978389 6:38124629-38124651 CTAGAGTTCCAGATGGGCATGGG - Intronic
1009691320 6:67036796-67036818 CCAGAGGCTCAGAAGGGTAGTGG - Intergenic
1010951928 6:82047370-82047392 CATGAAGCCCAAATCGGTATGGG + Intergenic
1011387893 6:86817214-86817236 CCAGAGGCCAAGAAGGGTAGTGG + Intergenic
1012744785 6:103072083-103072105 CAAGAGGCTGAGAAGGGTAGTGG + Intergenic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1017052062 6:150402431-150402453 AAGGAGGCCCAGATGTGTGTAGG + Exonic
1017319244 6:153069443-153069465 CCAGAGGCCAGGAAGGGTATTGG + Intronic
1022902440 7:34824578-34824600 CCAAAGGCCCAGCAGGGTATAGG - Intronic
1023715729 7:43042355-43042377 CAAGGGGCCCTGGTGGGTAGAGG - Intergenic
1024428832 7:49262169-49262191 GAAGAGGCCCAGCTGGGTGAAGG + Intergenic
1029837800 7:103331512-103331534 CCAGAGGCTGAGAAGGGTATTGG - Intronic
1035274516 7:157739619-157739641 CAAGAGTCCCAGATGGCAGTTGG - Intronic
1039018227 8:33176726-33176748 CCAGAGGCCAAGAAGGGTAGGGG + Intergenic
1040597920 8:48858275-48858297 CAGGTGGCGCAGATGGGGATGGG + Intergenic
1042066770 8:64885975-64885997 CCAGAGGCCCGGATGAGTAGAGG - Intergenic
1042206178 8:66332025-66332047 CAAGCTGCCCAGATAGGTAGGGG + Intergenic
1044176501 8:89130638-89130660 CTAGAGGCCGCGATGGGTAGGGG + Intergenic
1045512080 8:102819608-102819630 CCATAGGCCCGGATGGGTAATGG - Intergenic
1046202327 8:110943312-110943334 CTAGAGGCTCAGAAGGGTAGTGG + Intergenic
1047968742 8:130066884-130066906 GAAGAGGCCCTGTTGGGTCTGGG + Intronic
1052003729 9:23320809-23320831 CAAATGGCACAGATGGGTGTGGG - Intergenic
1052185366 9:25587487-25587509 CAGGAGGCCTAGTTGGGGATTGG + Intergenic
1052363624 9:27587340-27587362 CCAGAGGCTCAGAGGGGTAATGG - Intergenic
1055901260 9:81240904-81240926 CAAGAGGCCCTGTTGGGTCAGGG + Intergenic
1060188541 9:121578135-121578157 GAAGAGGCTCAGAAGGGTTTGGG - Intronic
1187833946 X:23411857-23411879 CCAGAGGCAGAGATGGGTAGTGG + Intergenic
1189547060 X:42052369-42052391 CCAGAGGCCAAGAAGGGTAGGGG - Intergenic
1190163286 X:48049773-48049795 CAAGAGGCCTTGCTGGGTCTGGG - Intronic
1190532328 X:51392051-51392073 CCAGAGGCTGAGATGGGTAGTGG + Intergenic
1190706154 X:53029967-53029989 CAAGAGGCCCTGTTGGGTCCGGG - Intergenic
1191783367 X:64892364-64892386 CTAGAGGTCCAAATGGGTTTGGG + Intergenic
1192317626 X:70065470-70065492 AAAGAGGCCCAGCTGGGTAGCGG + Intergenic
1192347209 X:70320659-70320681 CCAGAGGCCAAGAAGGGTGTGGG + Intronic
1193085442 X:77444878-77444900 AAAGAGCCCCAGATGGGCAATGG + Intergenic
1193282950 X:79676760-79676782 GAAGAGGCCCATATAGGTATTGG - Intergenic
1194107167 X:89784786-89784808 CAAGAGGCTGAGAAGGGTAGTGG + Intergenic
1195484137 X:105383261-105383283 CCAGAGGCTCAGAAGGGTAGTGG - Intronic
1195750939 X:108161664-108161686 CAAGAGCCCCAGGTGGGCCTGGG + Exonic
1196033003 X:111111782-111111804 CAAGAGGCCCAGAGGAGTATGGG - Intronic
1196089566 X:111725452-111725474 CCAGAGGCTCAGAAGGGTATTGG + Intronic
1200459126 Y:3432648-3432670 CAAGAGGCTGAGAAGGGTAGTGG + Intergenic
1201357291 Y:13111544-13111566 CTAGTGGCTCAGATGGGGATTGG + Intergenic
1202025833 Y:20522334-20522356 CCAGAGGCTCGGATGGGTAGTGG - Intergenic