ID: 1165474379

View in Genome Browser
Species Human (GRCh38)
Location 19:36021702-36021724
Sequence GCATGAGCCACCACATTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 7, 2: 28, 3: 121, 4: 508}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165474372_1165474379 7 Left 1165474372 19:36021672-36021694 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG 0: 1
1: 7
2: 28
3: 121
4: 508
1165474370_1165474379 14 Left 1165474370 19:36021665-36021687 CCTTCTGCCTCAGCCTCCCAAAG 0: 1457
1: 29525
2: 84197
3: 163693
4: 170597
Right 1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG 0: 1
1: 7
2: 28
3: 121
4: 508
1165474376_1165474379 -2 Left 1165474376 19:36021681-36021703 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG 0: 1
1: 7
2: 28
3: 121
4: 508
1165474377_1165474379 -3 Left 1165474377 19:36021682-36021704 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG 0: 1
1: 7
2: 28
3: 121
4: 508
1165474374_1165474379 1 Left 1165474374 19:36021678-36021700 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG 0: 1
1: 7
2: 28
3: 121
4: 508
1165474369_1165474379 30 Left 1165474369 19:36021649-36021671 CCTGGGCTCAAGCGATCCTTCTG 0: 203
1: 3642
2: 26919
3: 111205
4: 246362
Right 1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG 0: 1
1: 7
2: 28
3: 121
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165474379 Original CRISPR GCATGAGCCACCACATTTGG CGG Intronic
900758622 1:4455137-4455159 GAGTGAGCCACCACTCTTGGAGG - Intergenic
900918922 1:5658640-5658662 TCATAAGCCACCAGGTTTGGTGG - Intergenic
901094693 1:6668712-6668734 GCACGAGCCACCATGTCTGGTGG + Intronic
901814545 1:11786725-11786747 CCATGAGCCACCACACCTGCTGG + Exonic
901856120 1:12045229-12045251 GCTTAAGCCACCCCATTTGCGGG + Intergenic
902778764 1:18691257-18691279 GCATGAGCCACCATACATGGAGG + Intronic
902866049 1:19280356-19280378 GCCTCAGCCACCACAGTAGGTGG + Intergenic
902962154 1:19971564-19971586 GCATGAGCCACCACGCTGGGTGG + Intergenic
903407260 1:23108326-23108348 GCATGAGCCACCACCCTAGTGGG - Intronic
903521259 1:23951997-23952019 GCATGAGCCACCTCGCCTGGCGG - Intergenic
904366090 1:30011796-30011818 GCAGGAGCCCCCAGATGTGGGGG + Intergenic
904535654 1:31197825-31197847 GCATGAGCCACTGCACCTGGTGG + Intronic
904731700 1:32597273-32597295 GCGTGAGCCACCACGTCTGCTGG + Intronic
905089056 1:35412157-35412179 GCATGAGCCACCGCACCTGGCGG + Intronic
905252985 1:36661673-36661695 GCATGAGCCACCACCCTCAGCGG + Intergenic
905434056 1:37944986-37945008 GCATGAGCCACCGCACCTGGTGG - Intronic
905907991 1:41632512-41632534 GCATGAGCCACCACGCCTGGCGG + Intronic
906173084 1:43744519-43744541 GCGTGAGCCACCACACCTGGCGG + Intronic
906227757 1:44135800-44135822 GTGTGAGCCACCACACCTGGGGG + Intergenic
906578060 1:46908809-46908831 GTGTGAGCCACCACATGTGGTGG - Intergenic
906620021 1:47268811-47268833 GCGTGAGCCACCACACCTGGCGG - Intronic
907508633 1:54941895-54941917 GCAGGAGCCAGACCATTTGGGGG - Intergenic
908262689 1:62351176-62351198 GCGTGAGCCACCGCACCTGGCGG - Intergenic
908841978 1:68289056-68289078 GCATAAGCCACCACATTGGCTGG - Intergenic
909634974 1:77807442-77807464 GCGTGAGCCACCACGGTTGGTGG + Intronic
909762527 1:79309643-79309665 GCAGGAGCCAACACATTTGCTGG - Intergenic
910595785 1:88978933-88978955 GCATGAGCCACCACACCTGGTGG + Intronic
910785414 1:90992764-90992786 GCATGAGCCACTGCACCTGGCGG - Intronic
910881419 1:91925346-91925368 GCATGAGCCACCACTTAGGCTGG + Intergenic
912022921 1:105128370-105128392 TCATGAGCCACCGCATCTGGAGG + Intergenic
912126317 1:106543296-106543318 GCATGAGCCACCATGCCTGGCGG - Intergenic
912344479 1:108952056-108952078 GCATGAGCCACTGCACCTGGTGG + Intronic
912658568 1:111508814-111508836 GCATGAGCCACCGCGCCTGGCGG - Intronic
912842445 1:113051017-113051039 GCATGAGCCACCGCACCCGGTGG + Intergenic
913588753 1:120302473-120302495 GCGTGAGCCACCACGTCTGGCGG - Intergenic
913619432 1:120595896-120595918 GCGTGAGCCACCACGTCTGGCGG + Intergenic
913653275 1:120938444-120938466 GCATGAGCCACCACATCTGGTGG + Intergenic
913994501 1:143640798-143640820 GCATGAGCCACTGCACCTGGCGG - Intergenic
914167830 1:145190599-145190621 GCATGAGCCACCACATCTGGTGG - Intergenic
914246117 1:145886768-145886790 GCATGAGCCACCACTATTCCTGG + Intergenic
914518963 1:148398556-148398578 GCATGAGCCACCACATCTGGTGG + Intergenic
914570776 1:148914344-148914366 GCGTGAGCCACCACGTCTGGCGG - Intronic
914602054 1:149215919-149215941 GCGTGAGCCACCACGTCTGGCGG + Intergenic
914643456 1:149632595-149632617 GCATGAGCCACCACATCTGGTGG + Intergenic
914741029 1:150465123-150465145 GCATGAGCCACCATGCCTGGTGG + Intronic
914855817 1:151349739-151349761 GCATGAGCCACCACACCAGCCGG - Intergenic
914870612 1:151470703-151470725 GCATGCGCCACCACTCCTGGTGG - Intergenic
915286933 1:154859070-154859092 GGTTGAGCCACCGCCTTTGGAGG - Intronic
916476044 1:165169844-165169866 GCATGAGCCACCGCATCTGGTGG + Intergenic
917740068 1:177953284-177953306 GCATGAGCCACCACACCCAGTGG + Intronic
918326965 1:183419048-183419070 GCATGAGCCACCGCACCCGGCGG - Intergenic
919582133 1:199389470-199389492 GCAAGAACTACCACTTTTGGAGG - Intergenic
919782085 1:201227571-201227593 GCATCCGCCACCACACCTGGCGG + Intronic
919971469 1:202582603-202582625 GCATGAGCCACTGCACCTGGTGG - Exonic
922315369 1:224436891-224436913 AAATGAGCCAGTACATTTGGCGG - Intronic
923199516 1:231697727-231697749 GCATGAGCCACCATGCCTGGTGG + Intronic
923399468 1:233602177-233602199 GCATGAGCCACCACGCCCGGCGG + Intergenic
923580136 1:235201602-235201624 GTGTGAGCCACCGCATCTGGCGG + Intronic
924234298 1:241987774-241987796 GCATGAGCCACTGCACCTGGCGG - Intergenic
924334384 1:242972757-242972779 GCATGAGCCACCACTGTGGCTGG - Intergenic
1063778185 10:9288600-9288622 ACGTGAGCCACCACACCTGGTGG - Intergenic
1064063856 10:12163600-12163622 GCATGAGCCACCATGCCTGGTGG + Intronic
1064104074 10:12486436-12486458 GCATGAGCCACTGCACCTGGCGG + Intronic
1064175863 10:13074464-13074486 GCGTGAGCCACCACAACCGGCGG + Intronic
1064335950 10:14441518-14441540 GCATGAACCACCACACCCGGCGG - Intronic
1064469166 10:15617677-15617699 GCATGAGCCACTGCACCTGGCGG + Intronic
1064527197 10:16269441-16269463 GCATGAGCCACCTCACCAGGCGG - Intergenic
1064670452 10:17708168-17708190 GCATGAGCCACCATGCCTGGCGG + Intronic
1064851063 10:19708941-19708963 GCATGAGCCACCACATCTGGCGG + Intronic
1065813538 10:29464154-29464176 GCATGAGCCACCACTCCCGGTGG - Intronic
1066431188 10:35353205-35353227 TCATGAGCTACCACACGTGGTGG + Intronic
1066779607 10:38929594-38929616 GCATGAGCCACCATATGGGCTGG + Intergenic
1067486620 10:46656598-46656620 GCATGAGCCACCGCGCTGGGTGG + Intergenic
1067608131 10:47685064-47685086 GCATGAGCCACCGCGCTGGGTGG - Intergenic
1069737084 10:70663833-70663855 GTGTGAGCCACCACAACTGGCGG - Intergenic
1070151281 10:73806725-73806747 GCATGTGGCTCCACATGTGGGGG + Exonic
1070247976 10:74749619-74749641 GCATGAGCCACCACCATGTGCGG - Intergenic
1070336203 10:75456954-75456976 GCATGAGTCACCTCACGTGGCGG + Intronic
1071286715 10:84155444-84155466 GCATGAGCCACCACGCCTGCAGG - Intergenic
1071321169 10:84459802-84459824 GCATGAGCCACCATGCCTGGTGG + Intronic
1071623728 10:87146774-87146796 GCATGAGCCACCACGCTGGGCGG - Intronic
1071865231 10:89722387-89722409 GCATGAGCCACCGCGCCTGGCGG - Intronic
1072121328 10:92407761-92407783 GCATGAGCCACCACACCTGGTGG + Intergenic
1072174752 10:92908333-92908355 GTGTGAGCCACCACACCTGGTGG + Intronic
1072273223 10:93797798-93797820 GCATGAGACACCAAATTCTGTGG + Exonic
1072445457 10:95495163-95495185 GCATGAGCCACCGCACCCGGTGG + Intronic
1073366795 10:102949453-102949475 GCATGAGCCACCACACCTGGCGG + Intronic
1073437272 10:103526788-103526810 GCATGAGCCACCACGCTGGCTGG + Intronic
1073881691 10:107988616-107988638 GCGTGAGCCACCGCACCTGGTGG + Intergenic
1074090574 10:110249979-110250001 GTATGAACCTCAACATTTGGTGG - Intronic
1074155661 10:110796926-110796948 ACATGAGCCATCACATATTGGGG + Intronic
1075111631 10:119591121-119591143 GTGTGAGCCACCACACCTGGTGG - Intronic
1075958616 10:126546842-126546864 GCCTGAGCCACCGCACCTGGTGG - Intronic
1076418504 10:130310152-130310174 GCATGAGCCACCACGTCCAGCGG - Intergenic
1076599449 10:131647420-131647442 GCAGGAGCCCCCAGATTTTGTGG + Intergenic
1076709747 10:132325999-132326021 GCATGAGCCACCACGCTGGCCGG + Intronic
1077027080 11:445367-445389 GCATGAGCCACTGCACTTGGCGG + Intergenic
1078225654 11:9389327-9389349 GCATGAGCCACCACACCAGCCGG + Intronic
1079355594 11:19727814-19727836 GCATGGACCACCACAGGTGGAGG + Intronic
1080433642 11:32220462-32220484 GCCTGGGCCAGCACTTTTGGAGG + Intergenic
1081553484 11:44135670-44135692 GCATGAGCCACTGCACTGGGTGG + Intronic
1082026454 11:47576129-47576151 GCATGAGCCACCATGCCTGGCGG + Intronic
1083030022 11:59583916-59583938 GCATGAGCCACCACACCTGATGG + Intronic
1084050150 11:66594076-66594098 GCATGAGCCACCACACCCAGTGG - Intronic
1084367115 11:68709029-68709051 GCGTGAGCCACCACACCCGGCGG + Intronic
1084585440 11:70058901-70058923 GCGTGAGCCACCGCACTCGGCGG - Intergenic
1086110534 11:83193859-83193881 GCACTAGCCACCACGTGTGGAGG + Intronic
1086201089 11:84203300-84203322 GCGTGAGCCACCACACCTGGCGG - Intronic
1086462015 11:87015402-87015424 GTGTGAGCCACCACACCTGGAGG + Intergenic
1088090567 11:106034619-106034641 GCATGAGGCACTACTTTTGCTGG + Intergenic
1088667287 11:112106052-112106074 GCATGCGCCACCACATCTGGTGG + Intronic
1089822260 11:121239359-121239381 TCATGAGCCACAACATCTAGTGG + Intergenic
1090346502 11:126075896-126075918 GCGTGAGCCACCGCACCTGGCGG - Intergenic
1090725921 11:129527162-129527184 GCGTGAGCCACCACACCGGGTGG - Intergenic
1091485923 12:888295-888317 CCATCAGCCACCACATTTGGGGG + Intronic
1092212647 12:6657649-6657671 GCTTGAGCCACCACACCTGACGG - Intronic
1093493341 12:19728543-19728565 GCATGAGCCACCACACCTGACGG - Intergenic
1093823130 12:23646445-23646467 GCATGAGCCACCGCGCCTGGTGG + Intronic
1093960306 12:25265348-25265370 CAATGAGCTACCACATCTGGTGG - Intergenic
1094403945 12:30094480-30094502 GTGTGAGCCACCACACCTGGTGG - Intergenic
1095569822 12:43672151-43672173 GCACGAGCCACCACACCTGGTGG - Intergenic
1095707529 12:45253886-45253908 GCATGAGCCACCACACTCCGTGG - Intronic
1096141619 12:49247274-49247296 GCATGAGCCACCAAGTCCGGCGG - Intronic
1096298517 12:50404966-50404988 GCGTGAGCCACCACACCTGGCGG + Intronic
1096671432 12:53200646-53200668 GCATGAGCCACCACGTCCGGAGG - Intronic
1097053999 12:56239333-56239355 GCTGGAGCCACCACAATTAGAGG + Exonic
1097323293 12:58248407-58248429 GCATGAGCCACCATGCCTGGTGG + Intergenic
1097924901 12:65116652-65116674 GCGTGAGCCACCACGCCTGGTGG - Intronic
1098432292 12:70433263-70433285 ACATGAGCCATCATATTTTGGGG - Exonic
1099100622 12:78435921-78435943 GCATGAGCCACCACACTGGCCGG - Intergenic
1099548962 12:84019041-84019063 GCGTGAGCCACCACGCCTGGTGG - Intergenic
1100227249 12:92571703-92571725 ACATGAGCTACCGCATCTGGCGG - Intergenic
1100413646 12:94349003-94349025 GTGTGAGCCACCACACCTGGTGG - Intronic
1101365772 12:104069023-104069045 GCATGAGCCACAACGCCTGGTGG - Intronic
1101916709 12:108901625-108901647 GCATAAGCCACCACGCCTGGCGG + Intergenic
1101962862 12:109262895-109262917 GCATGAGCTACCATGATTGGAGG + Intronic
1101996962 12:109532654-109532676 GCACGAGCTAGCACATTTGCAGG + Intronic
1102282035 12:111626040-111626062 GCATGAGCCACCGCACCCGGCGG + Intergenic
1102372382 12:112392934-112392956 GCATGAGCCACCACACCCAGAGG - Intergenic
1102693047 12:114776596-114776618 GCGTGAGCCACCACATCTGATGG + Intergenic
1103039195 12:117680987-117681009 GCATGAGCCACCACACCTGGTGG - Intronic
1103354372 12:120308887-120308909 GCATGAGCCACCACGCCCGGCGG - Intronic
1103384269 12:120519588-120519610 GCATGAGCCATCACGCCTGGCGG - Intronic
1103646289 12:122395829-122395851 GCGTGAGCCACCACGCCTGGCGG - Intronic
1103807886 12:123588163-123588185 CCGGGAGCCAGCACATTTGGTGG + Intronic
1104071335 12:125348613-125348635 GTGTGAGCCACCACACCTGGCGG + Intronic
1104571752 12:129932151-129932173 GCAACAGCCACCACATTTTGTGG - Intergenic
1105046091 12:133004762-133004784 GCATGAGGTACCACATTTGATGG + Intronic
1105233674 13:18525014-18525036 GCATGAGCCACCATATGGGCTGG + Intergenic
1105305055 13:19162480-19162502 GCGTCAGCCACCACATCTGCTGG - Intergenic
1105955194 13:25275579-25275601 GCGTGAGCCACCACACCCGGCGG - Intronic
1106399144 13:29411086-29411108 GCATGAGCCAGCACTTTGGGAGG - Intronic
1106461668 13:29975880-29975902 GCATGAGCCACCACGCCCGGCGG - Intergenic
1107012140 13:35679961-35679983 GCATGAGCCACCACACCTGGCGG + Intergenic
1107124902 13:36836569-36836591 GTATGAGCCACCACACTGGCTGG - Intergenic
1107904049 13:45045978-45046000 GCGTGAGCCACCACACCCGGTGG + Intergenic
1108009576 13:45991080-45991102 GCATGAGCCACCATGCTTGATGG + Intronic
1108553880 13:51573884-51573906 GTGTGAGCCACCACACCTGGCGG - Intergenic
1108664550 13:52616903-52616925 GCGTGAGCCACCGCGTCTGGTGG - Intergenic
1108688314 13:52839895-52839917 GCGTGAGCCACCGCACCTGGCGG + Intergenic
1111552873 13:89838785-89838807 GCGGGAGCCACCATATTGGGTGG - Intergenic
1111851465 13:93581426-93581448 GCATGAGCCACAATACCTGGCGG - Intronic
1112775074 13:102835096-102835118 GCATGAGCCACCGCGCATGGTGG - Intronic
1113167985 13:107464798-107464820 GCATGAGCCACCACACCCGGCGG + Intronic
1115019642 14:28660656-28660678 GGAGGAGCCACCACAACTGGTGG + Intergenic
1115147701 14:30244688-30244710 GCATGAGCCACTGCACCTGGTGG + Intergenic
1115613442 14:35070606-35070628 GCGTGAGCCACCACACCCGGCGG + Intronic
1116810307 14:49533748-49533770 GCATGAGCCATCGCAGCTGGGGG - Intergenic
1116817441 14:49597336-49597358 GCGTGAGCCACCGCACCTGGCGG + Intronic
1117385005 14:55202723-55202745 GCATGAGCCACCACACCTGATGG - Intergenic
1117493678 14:56277821-56277843 GCATGAGCAACTCCATTTGAGGG + Intronic
1117761219 14:59030925-59030947 GCATGAGTCCAAACATTTGGTGG + Intergenic
1117772942 14:59152664-59152686 GCGTGAGCCACCTCATTTCTGGG - Intergenic
1117844646 14:59897856-59897878 GCATGAGCCACCACGTCCAGTGG + Intergenic
1117986125 14:61387865-61387887 GCATGAGCCACCACACCCAGCGG - Intronic
1118021672 14:61722513-61722535 GCATGCGCCACCACACCTGGTGG + Intronic
1118942663 14:70352465-70352487 GCATGAGCCACCACACCCAGTGG + Intronic
1120216638 14:81687714-81687736 GTGTGAGCCACCACACCTGGCGG + Intergenic
1120899283 14:89561490-89561512 GCGTGAGCCACCACGCTTGACGG + Intronic
1121761767 14:96451052-96451074 GCATGAGCCACGGCACTCGGCGG + Intronic
1122259141 14:100502190-100502212 GCAAGGGCCACCACAGTGGGGGG - Intronic
1202937656 14_KI270725v1_random:106661-106683 GCATGAGCCACCATATGGGCTGG - Intergenic
1124603066 15:31150712-31150734 GCATGAGCCACTGCACTTGGCGG + Intronic
1124957506 15:34368948-34368970 GCGTGAGCCACCGCACCTGGCGG + Intergenic
1125971694 15:43917058-43917080 GCGTGAGCCACCACGCCTGGCGG + Intronic
1126010995 15:44302423-44302445 GCATGAGCCACCACGCCTAGTGG + Intronic
1126641339 15:50830061-50830083 GCATGAGCCACCACACAGAGTGG - Intergenic
1127090757 15:55464685-55464707 GCATGAGCCACCACACCTGGCGG - Intronic
1127532585 15:59859322-59859344 GCATGAGCCACCACATGAGGGGG - Intergenic
1127865058 15:63025915-63025937 GTATAAGCCACTACATTTTGAGG + Intergenic
1129108022 15:73322563-73322585 GCAAGAGCCACCTCTTCTGGGGG - Exonic
1129147823 15:73664979-73665001 GCATGAGCCACTGCACCTGGTGG + Intergenic
1129420728 15:75424150-75424172 GCATGAGCCACCACGCCCGGCGG - Intronic
1129489271 15:75907613-75907635 GCATGAGCCACCATGCCTGGCGG - Intronic
1129735279 15:77957471-77957493 GCATGAGCCACCATGCATGGTGG + Intergenic
1129805333 15:78451941-78451963 GAGTGAGCCACCACACCTGGTGG + Intronic
1129901948 15:79158032-79158054 GCATGTGCCACCACCCATGGAGG + Intergenic
1130119024 15:81031002-81031024 GCAAGAGCCCCCACAACTGGTGG + Intronic
1133287971 16:4699313-4699335 GCCTGAGCCACCAGAGTAGGAGG - Intronic
1133892483 16:9893745-9893767 GCATGAGCCACCACACCTGCCGG + Intronic
1134037744 16:11044648-11044670 GCATGAGCCACCATGCCTGGCGG - Intronic
1134067122 16:11235806-11235828 GCATGAGCCACTGCACCTGGCGG - Intergenic
1135791464 16:25400526-25400548 GCATGAGCCACAGCACCTGGTGG + Intergenic
1136689213 16:32016492-32016514 GCATGCACCACCACACCTGGCGG + Intergenic
1136789808 16:32960025-32960047 GCATGCACCACCACACCTGGCGG + Intergenic
1136880004 16:33893911-33893933 GCATGCACCACCACACCTGGCGG - Intergenic
1136939862 16:34513235-34513257 GCATGAACCACCATATGTGCTGG - Intergenic
1136956225 16:34789585-34789607 GCATGAACCACCATATGTGCTGG + Intergenic
1136959957 16:34835331-34835353 GCATGAACCACCATATGTGCTGG + Intergenic
1137088636 16:36160415-36160437 GCATGAACCACCATATTGGCTGG + Intergenic
1137315956 16:47323367-47323389 GCCTGAGCTACCACATTAGCAGG + Intronic
1137978329 16:53049454-53049476 ACATGAGCCACCGCACCTGGAGG + Intergenic
1138371299 16:56529041-56529063 GCATGGGCCACCACGCCTGGTGG - Intergenic
1139417428 16:66825165-66825187 GCATGAGCCACCACACCCGCCGG - Intronic
1140099121 16:71899296-71899318 GCATGAGCCGCCACACCTGGTGG - Intronic
1140118659 16:72064773-72064795 GTATGGGCCACCAAATTTGTTGG - Intronic
1140128969 16:72141215-72141237 GCATGAGCTACCACATCCGGTGG + Intronic
1140868442 16:79084691-79084713 GCATGAGCCACCGCACCTGGAGG + Intronic
1141639848 16:85334680-85334702 TCTTGAGCCCCCACATTTAGGGG - Intergenic
1203092011 16_KI270728v1_random:1221483-1221505 GCATGCACCACCACACCTGGCGG + Intergenic
1142665005 17:1457546-1457568 GCGTGAGCCACCGCACTCGGCGG + Intronic
1142916395 17:3142705-3142727 GCGTGAGCCACCACACTGGCAGG + Intergenic
1142985659 17:3694048-3694070 GCATGAGCCACTACACTCAGCGG + Intronic
1143192296 17:5048840-5048862 GCATGAGCCACCATGCCTGGTGG - Intronic
1143244942 17:5476499-5476521 GCATGAGCCACCACACCTGCCGG - Intronic
1143597714 17:7925245-7925267 GCATGAGCCACCACGCCTGGTGG - Intronic
1144235915 17:13260360-13260382 GCATGAGCTACCACATCTGGTGG + Intergenic
1144406829 17:14960018-14960040 GCATGAGCCACTGCAACTGGAGG - Intergenic
1144691195 17:17265677-17265699 GCGTGAGCCACCTCACCTGGGGG + Intronic
1145025291 17:19463732-19463754 GCATGAGCCACCACACCCAGCGG - Intergenic
1145413033 17:22690428-22690450 GCATGAGCCACCATGCATGGCGG + Intergenic
1145708917 17:26950263-26950285 GCATGAGCCACCATATGGGCTGG + Intergenic
1145778828 17:27548547-27548569 GCATGAGCCAGCACTTTCGGAGG - Intronic
1146192205 17:30779374-30779396 GCATGCGCCACCACGCCTGGGGG + Intronic
1146677437 17:34783208-34783230 GCATGAGCCACCGCGCCTGGAGG - Intergenic
1146858180 17:36272643-36272665 GTGTGAGCCACCACACTCGGTGG + Intronic
1147076829 17:37995900-37995922 GTGTGAGCCACCACACTCGGTGG - Intronic
1147088500 17:38076706-38076728 GTGTGAGCCACCACACTCGGTGG + Intergenic
1147108710 17:38243817-38243839 GTGTGAGCCACCACACTCGGTGG - Intergenic
1147127595 17:38382765-38382787 GCGTGAGCCACCACGCTTGGCGG + Intronic
1147521329 17:41176209-41176231 ACAGGAGCCACCTCATCTGGAGG + Intergenic
1147664377 17:42137023-42137045 GCATGAGCCACCTCACCCGGCGG - Intronic
1147834658 17:43321524-43321546 GCGTGAGCCACCACGCCTGGCGG - Intergenic
1148033075 17:44635898-44635920 GCATGAGCCACCATGCCTGGCGG - Intergenic
1148420743 17:47544316-47544338 GTGTGAGCCACCACACTCGGCGG + Intronic
1148592759 17:48829097-48829119 GCATGAGCCACCACACCCAGCGG - Intergenic
1148739220 17:49882780-49882802 GCATTTGCCACCACCTTTAGAGG + Intergenic
1149327031 17:55542415-55542437 GCATGAGCCACCGCGCCTGGCGG - Intergenic
1149737608 17:59010771-59010793 GCATGAGCCACTGCGCTTGGTGG + Intronic
1149763017 17:59250338-59250360 GTGTGAGCCACCACATCTGCTGG - Intronic
1149782291 17:59407638-59407660 GCTTGAGCCACCACGCCTGGTGG + Intergenic
1149798779 17:59546716-59546738 GCGTGAGCCAGCACTTTGGGAGG - Intergenic
1149812926 17:59695373-59695395 GCATGAGCCACCACACCTGGTGG - Exonic
1149950259 17:60977456-60977478 GCATGAGCCATTGCATTTGGCGG + Intronic
1150086809 17:62277767-62277789 GTGTGAGCCACCACACCTGGTGG - Intronic
1150228582 17:63537715-63537737 GCCTGAGCCACCACACCCGGCGG + Intronic
1150690096 17:67358201-67358223 GCCTGAGCCACTGCATCTGGTGG + Intronic
1151245992 17:72795126-72795148 GTATGAGCCACCAAATTTGCAGG - Intronic
1151369270 17:73637653-73637675 GCATGAGCCACCGCGCCTGGAGG + Intronic
1151445370 17:74160179-74160201 GCATGAGCCACTGCACCTGGTGG - Intergenic
1151455038 17:74221071-74221093 GCGTGAGCCACCACACCTGGCGG + Intronic
1153006672 18:503474-503496 GCGTGAGCCACCACGTCTGGCGG - Intergenic
1153018862 18:608570-608592 GCATGAGCCACTGCACCTGGTGG - Intronic
1153547754 18:6226125-6226147 GCATGGGCCACCACATCTGGCGG - Intronic
1153877789 18:9390577-9390599 GCATGAGCCATCACACTGGCTGG + Intronic
1154257639 18:12797870-12797892 GCAGGTCCCACCACATTTGGCGG + Intronic
1154519346 18:15210446-15210468 GCATGAGCCACCATATGGGCTGG - Intergenic
1154933904 18:21031322-21031344 GCGTGAGCCACCACGCCTGGTGG - Intronic
1155031649 18:21990277-21990299 GCATGAGTCACTACATCTGACGG - Intergenic
1156586377 18:38435561-38435583 GCATGAGCTTCAACATCTGGAGG - Intergenic
1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG + Intergenic
1157211100 18:45742636-45742658 GTATGAGCCACCGCACCTGGCGG + Intronic
1157262520 18:46188480-46188502 GCGTGAGCCGCGACATGTGGCGG + Intronic
1158069017 18:53448576-53448598 GTGTGAGCCACCACATTTTTAGG - Intronic
1158452878 18:57582543-57582565 GCTTGAGCCCAGACATTTGGGGG + Intronic
1158630244 18:59107374-59107396 GCGTGAGCCACCGCACCTGGTGG - Intergenic
1160801259 19:970751-970773 GCATTAGCCACCACACCCGGCGG + Intronic
1161389455 19:4013659-4013681 GCTGGAGCCACCTCATCTGGAGG + Intronic
1161544193 19:4870058-4870080 GCATGAGCCACCACACCCGGTGG + Intergenic
1161764409 19:6198665-6198687 GCATGAGCCACCACGCCCGGCGG - Intronic
1162678054 19:12315410-12315432 GCGTGAGCCACCACGCCTGGCGG - Intergenic
1162685012 19:12375335-12375357 GCGTGAGCCACCGCGTCTGGTGG + Intergenic
1162991354 19:14304545-14304567 GCATGAGCCACCACTTTAGGAGG - Intergenic
1162991382 19:14304739-14304761 ACATGAGCCACCGCACCTGGTGG + Intergenic
1163600005 19:18243386-18243408 GCGTGAGCCACCACATCCGGTGG + Intronic
1163807507 19:19408263-19408285 GCGTGAGCCACCACGCCTGGCGG + Intronic
1163911079 19:20193379-20193401 GCATGAGCCACCATGCCTGGTGG - Intronic
1163931900 19:20402436-20402458 GCATGAGCCACCACACCTGGTGG + Intergenic
1164005527 19:21145193-21145215 GCATGAGCCACCGCATAGGTGGG - Intronic
1164851798 19:31490297-31490319 GCATGAGCCACTGCACCTGGTGG + Intergenic
1165374881 19:35434636-35434658 GCAGCAGCCACCACACATGGAGG - Intergenic
1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG + Intronic
1165695826 19:37900279-37900301 GCATGAGCCACTGCACCTGGTGG - Intronic
1166524048 19:43499957-43499979 GTATGAGCCACCGCAGTTCGAGG - Intronic
1166599220 19:44079427-44079449 GCATGAGCCACCACACCCGGTGG - Intronic
1166715589 19:44965217-44965239 GCGTGAGCCACCGCACCTGGCGG - Intronic
1166945784 19:46395345-46395367 GCGTGAGCCACCACACCCGGTGG - Intergenic
1167001831 19:46749996-46750018 GCATGAGCCACCACATCGGCTGG + Intronic
1167351165 19:48975645-48975667 GCGTGAGCCACCACGCCTGGTGG - Intronic
1168045692 19:53792722-53792744 GCATGAGTCACCGCATCTGGCGG + Intergenic
1168054609 19:53855471-53855493 GCATGAGCCACCACGCCAGGCGG - Intergenic
1168144070 19:54409611-54409633 GCGTGAGCCACCACGTCTGGTGG - Intergenic
1168223304 19:54976625-54976647 GCATGAGCCACCTCACCTGGTGG + Intronic
1168342279 19:55631876-55631898 GCCTGAGCCACCGCACCTGGCGG - Intergenic
1168577165 19:57521905-57521927 ACATGAGCCACCGCACCTGGCGG + Intergenic
1168606619 19:57765530-57765552 GCATGAGCCACCGCACCCGGTGG - Intergenic
926610639 2:14943103-14943125 GCATGTGCTTCCAAATTTGGAGG - Intergenic
926830827 2:16960056-16960078 GCGTGAGCCACCGCACCTGGCGG + Intergenic
927571108 2:24161163-24161185 GCATGAGCCTCCACGCCTGGCGG - Intronic
928529855 2:32179975-32179997 GCATGAGACACCACTCTTGGCGG - Intronic
929095236 2:38257529-38257551 GCGTGAGCCACCGCACCTGGCGG - Intergenic
929201326 2:39240127-39240149 GCGTGAGCCACCACGCCTGGCGG - Intergenic
929679111 2:43970817-43970839 GCGTGAGCCACCACTCTTGGCGG - Intronic
930628906 2:53731119-53731141 GCGGGAGCCACCACACTCGGTGG - Intronic
930959734 2:57246340-57246362 ACATGAGCCACCACACCTAGTGG - Intergenic
931338302 2:61372563-61372585 GCATGAGCCACCATGCCTGGCGG - Intronic
931527778 2:63176496-63176518 GCATGAGCCACCACAGGAAGTGG - Intronic
932386953 2:71343848-71343870 GCATGAGCCACCGCGCCTGGCGG - Intronic
933357095 2:81224617-81224639 GCATGAGCCACCGCGCCTGGCGG - Intergenic
934249604 2:90338577-90338599 GCATGAACCACCACATGGGCTGG - Intergenic
934259972 2:91464870-91464892 GCATGAACCACCACATGGGCTGG + Intergenic
934303276 2:91796789-91796811 GCATGAGCCACCATATGGGCTGG + Intergenic
934468207 2:94285880-94285902 GCATGAGCCACCATATGGGCTGG - Intergenic
934637237 2:96001301-96001323 GCATGAGCCACCACACCCAGTGG + Intergenic
934970616 2:98760854-98760876 GCATGAGCCACCACGCCTGGCGG + Intergenic
935244179 2:101204024-101204046 GCGTGAGCCACCGCACCTGGTGG + Intronic
935413836 2:102793922-102793944 GCATGAGCCACCATGTGTGGTGG - Intronic
935789059 2:106574507-106574529 GCATGAGCCACCACGCTCGGCGG + Intergenic
936497747 2:113037137-113037159 GGATCAGCGACCACAGTTGGAGG + Intronic
937130438 2:119507931-119507953 GAATGAGCCAGCACTTTGGGAGG - Intronic
938380493 2:130833767-130833789 GCATGAGCCACCACACCCGGCGG - Intergenic
938507344 2:131900328-131900350 GCATGAGACACTACACCTGGCGG - Intergenic
938519333 2:132051075-132051097 GCATGAGCCACCATATGGGCTGG - Intergenic
939440641 2:142245071-142245093 GCATGAGCCACCGCACCCGGCGG - Intergenic
939550204 2:143605731-143605753 GCATGAGCCACCATGCCTGGAGG - Intronic
940525482 2:154808359-154808381 GGGTGAGCCACCACACTCGGCGG + Intronic
941011760 2:160308128-160308150 GCATGAGCCACCACACCCAGTGG - Intronic
941548396 2:166883457-166883479 GCGTGAGCCACCACACCCGGCGG - Intergenic
942089295 2:172473073-172473095 ACATGAGCCACCAGATTAGAGGG - Intronic
942746617 2:179241529-179241551 TCATGAGCCACTTCATTTGGTGG - Intronic
942766745 2:179466638-179466660 GTATGAGCCACCACACCTGGTGG - Intronic
942948440 2:181695776-181695798 GCATGAGCCACTGCACCTGGTGG + Intergenic
943152616 2:184133490-184133512 GCATAAGCCACCACACCCGGCGG - Intergenic
943253378 2:185560441-185560463 GCCTGAGCCACCACACCAGGTGG - Intergenic
943464873 2:188217467-188217489 GCAGGAATCACCACATTGGGTGG - Intergenic
943469543 2:188276410-188276432 GCATGAGCCACCGCGCCTGGCGG + Intergenic
944585966 2:201173950-201173972 GCGTGAGCCACCACACCCGGTGG + Exonic
944862538 2:203828693-203828715 GCCTGAGCCACCGCACCTGGCGG - Intergenic
945222293 2:207497238-207497260 ACATCAGCCACCACATCTGGCGG + Intergenic
945288196 2:208103274-208103296 GCATGAGCCACCACACTCAGCGG - Intergenic
945306116 2:208260362-208260384 GCGTGAGCCACCACGCCTGGCGG + Intronic
946178001 2:217933609-217933631 GCATGAGCCAGCAGAGATGGGGG + Intronic
946275134 2:218625980-218626002 GCATGAGCTACCATACCTGGTGG - Intronic
946350506 2:219148271-219148293 GCATGAGCCATCTCAGCTGGTGG - Intronic
946842783 2:223835374-223835396 GCATGAGCCACCGCACCTGGCGG - Intronic
947168490 2:227287151-227287173 GCGTGAGCCACCACGCCTGGCGG - Intronic
947847714 2:233258978-233259000 GCATGAGCCACCACACCCAGGGG + Intronic
947981920 2:234417891-234417913 GCATGAGCAACCGCACCTGGAGG + Intergenic
948191619 2:236063369-236063391 GCATGAGCCACCAGGAATGGTGG + Intronic
948976953 2:241469363-241469385 GTGTGAGCCACCACATGAGGAGG + Intronic
1168894806 20:1316668-1316690 GCATGCACCACCACACCTGGTGG + Intronic
1169294799 20:4385689-4385711 GCATGAGCCACCGCACCTGGCGG - Intergenic
1169380530 20:5103081-5103103 GCGTGAGCCACCACACCCGGTGG - Intronic
1169456381 20:5755837-5755859 GCATGGGCCACCACGTCTGGCGG + Intronic
1170840643 20:19922333-19922355 GCCTGAACCACCAGCTTTGGGGG + Intronic
1170912113 20:20583103-20583125 GCATCAGCCACAACATCTGTGGG + Exonic
1170934263 20:20796204-20796226 GCATGAGCCACTGCATCCGGAGG + Intergenic
1171155476 20:22869101-22869123 GCATGAGCCACCATGCCTGGCGG - Intergenic
1172003215 20:31797914-31797936 GCATGAGCCACCACACCCGGTGG - Intronic
1172171727 20:32939561-32939583 GCATGAGCCACCTCGCCTGGCGG + Intronic
1172339160 20:34142692-34142714 GCATGAGCCACTGCACCTGGTGG + Intergenic
1172698242 20:36836773-36836795 GCATGAGCCTCCACCTCTGGCGG + Intronic
1172841954 20:37907385-37907407 GCATGAGCCACCGCATCTAGTGG + Intronic
1173318152 20:41963350-41963372 GCACGTGCCACCACATCTGGCGG - Intergenic
1174025158 20:47567982-47568004 TCATGAGCCACCATACCTGGTGG + Intronic
1174040010 20:47692752-47692774 GCATGAGCCAACACACCTGGTGG + Intronic
1174219532 20:48942428-48942450 GCATGAGCCACCACACCTCCTGG + Intronic
1174470992 20:50760679-50760701 GCAGGGGCCACCACATTCGATGG + Intergenic
1174585002 20:51601624-51601646 GCATGAGCCACTGCATCTGGTGG - Intronic
1174665101 20:52250606-52250628 GCGTGAGCCACCACGCCTGGCGG + Intergenic
1175103941 20:56600693-56600715 GCATGAACCACCACACTGGCCGG - Intergenic
1175374952 20:58517773-58517795 GCATGTGCCACTACACCTGGAGG - Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1176224399 20:63987765-63987787 GTGTGAGCCACCACACCTGGGGG - Intronic
1176777658 21:13153289-13153311 GCATGAGCCACCATATGGGCTGG + Intergenic
1177035714 21:16039949-16039971 GCATGAGCCACCTCAGTTCATGG + Intergenic
1177071045 21:16508479-16508501 GCATGAGCCACTACACCTGGGGG + Intergenic
1177176286 21:17703849-17703871 GCATGAGCCACCGCGCCTGGCGG + Intergenic
1177318512 21:19492036-19492058 GCATGAGCTTCCAAATTTGGGGG - Intergenic
1178736645 21:35158552-35158574 GCATGAGTCACCACACTCAGTGG - Intronic
1178901663 21:36604015-36604037 GCATGAGCCACCACACCCAGGGG + Intergenic
1179596883 21:42448813-42448835 GCATGAGGCACCACATGTGTGGG - Intergenic
1180525253 22:16252643-16252665 GCATGAGCCACCATATCGGCTGG + Intergenic
1180652236 22:17387544-17387566 GCAGGAGCCACCACACCTGAGGG + Intronic
1180675655 22:17584497-17584519 GCGTGAGCCACCACGCTGGGCGG - Intronic
1180727818 22:17959593-17959615 GCATGAGCCACCACACCTCAGGG + Intronic
1181842633 22:25677078-25677100 GCATGAGCCACTGCACTTGGTGG - Intronic
1181905254 22:26189815-26189837 GCGTGAGCCACCGCACCTGGTGG - Intronic
1182329586 22:29541579-29541601 GCGTGAGCCACCACACCCGGTGG - Intronic
1182427264 22:30281058-30281080 GCGTGAGCCACCACGCCTGGTGG + Intergenic
1182523632 22:30901582-30901604 GCGTGAGCCACCACGCCTGGTGG - Intronic
1182591551 22:31384559-31384581 GCATGAGCCACTGCACCTGGCGG + Intergenic
1182624087 22:31633433-31633455 GCATGAGCCACCGCGCCTGGTGG - Intronic
1182684179 22:32108379-32108401 GCATGAGCCACCACACCAGCTGG + Intronic
1183873435 22:40758209-40758231 GCGTGAGCCACCGCACTCGGCGG + Intergenic
1184000362 22:41668815-41668837 GCATTAGCCACCGCGTCTGGTGG + Intergenic
1184135115 22:42544016-42544038 GCATGCGCCACCACGCCTGGTGG + Intergenic
1184644152 22:45887033-45887055 GCATGACCCAGAACCTTTGGGGG - Intergenic
1184646885 22:45900707-45900729 GCATGTGGGACCGCATTTGGTGG + Intergenic
1203237537 22_KI270732v1_random:19810-19832 GCATGAGCCACCATATGGGCTGG + Intergenic
1203290261 22_KI270735v1_random:30255-30277 GCATGAGCCACCATATGGGCTGG - Intergenic
949563088 3:5220814-5220836 GCATGAGCCACCACGCCTGATGG + Intergenic
950125663 3:10508336-10508358 GCATGAACCAACTCAGTTGGTGG - Intronic
951004059 3:17596596-17596618 GCATGAGCCACCACACCAGGTGG + Intronic
951212055 3:19986752-19986774 GCTTGAGCCACCACACCTGGCGG - Intronic
952881099 3:37986807-37986829 GCATGTGTCCCCACATCTGGTGG - Intergenic
953995465 3:47516074-47516096 ACATGAGCCACCTCACTCGGTGG - Intergenic
954071256 3:48144382-48144404 GCGTGAGCCACCGCGTCTGGTGG - Intergenic
954387343 3:50251089-50251111 GCATGAGCCACCACTCCCGGCGG + Intronic
955080814 3:55656436-55656458 GCATGAGCCACCATTCCTGGTGG + Intronic
955283361 3:57615545-57615567 GCGTGAGCCAGCACCTTGGGAGG + Intergenic
955287359 3:57655311-57655333 GCGTGAGCCACTGCATCTGGCGG + Intronic
956809021 3:72846576-72846598 GAGTGAGCCACCACATCTGGGGG + Intronic
956826307 3:73000103-73000125 GCATGAGCCACCACATCCGGTGG - Intronic
957122993 3:76120280-76120302 GCGTGAGCCACCACGCCTGGAGG + Intronic
957309404 3:78500542-78500564 GCATGAGCCACCGCGCCTGGCGG - Intergenic
958933126 3:100228989-100229011 GCATGAGCCACCATGCCTGGTGG - Intergenic
959676411 3:109041029-109041051 GCGTGAGCCACCACACCTGGTGG - Intronic
960187089 3:114656891-114656913 GCATACGCCACCACATCTGGTGG + Intronic
960513388 3:118576842-118576864 GCATGATCCCCTACTTTTGGAGG + Intergenic
960649724 3:119933594-119933616 GCGTGAGCCACCGCGCTTGGCGG - Intronic
960802511 3:121553771-121553793 GCGTGAGCCACCACTCTTGGCGG - Intergenic
961415084 3:126751219-126751241 GCATGAGCTACCACACATGGTGG - Intronic
961725716 3:128927970-128927992 GCTTGAGCCACCGCACCTGGCGG - Intronic
962750303 3:138430206-138430228 GCGTGAGCCTCCACACCTGGTGG - Intergenic
965756854 3:172036139-172036161 GCATGAGCCACCATGCCTGGTGG + Intergenic
965766594 3:172136982-172137004 GCATGAGCCACCACATCCGGCGG + Intronic
965790926 3:172387234-172387256 GCATGAGCCACCACACCCAGCGG + Intronic
966521694 3:180880795-180880817 GCATGAGCCACCACACCCGGCGG - Intronic
966848824 3:184151599-184151621 GCGTGAGCCACCACGCTTGGTGG - Intronic
967704617 3:192635138-192635160 GCATGAGCCACCACGCCTGACGG + Intronic
967795694 3:193596518-193596540 GCGTGCGCCACTGCATTTGGCGG + Intronic
967946100 3:194805450-194805472 GGAAGAACCACCAGATTTGGGGG + Intergenic
968141956 3:196265640-196265662 GCGTGAGCCACCACACCCGGTGG - Intronic
968777318 4:2550714-2550736 GCATGAGCCACCACGCCTGTTGG + Intronic
969059418 4:4423268-4423290 GCATGTGCTACCACATGGGGTGG + Intronic
970562687 4:17298579-17298601 GCATGAGCCACCATGCCTGGTGG - Intergenic
971188038 4:24400064-24400086 GTGTGAGCCACCACACCTGGGGG + Intergenic
971296263 4:25395728-25395750 GCATGAGCCACCACACCTGGTGG + Intronic
971401752 4:26282799-26282821 GCATGAGCCACCACACCTGGCGG + Intronic
971739035 4:30497382-30497404 GCACAAGACACCACATTTGCTGG - Intergenic
972293203 4:37711109-37711131 GTATGAGCCACCCCACCTGGTGG - Intergenic
972473943 4:39433158-39433180 GCATGAGCCACCCCGCCTGGTGG + Intronic
972509836 4:39758395-39758417 GCATGAGCCACTGCACGTGGCGG - Intronic
972581898 4:40402647-40402669 GCATGAGGCACCACACCTGGTGG + Intergenic
972626619 4:40805629-40805651 TCATAAGCCACCAAGTTTGGAGG - Intronic
972918583 4:43909135-43909157 GCATGAGCCACCGCACCTGGCGG - Intergenic
972994556 4:44864215-44864237 GCGTGAGCCACCGCACCTGGCGG - Intergenic
973964825 4:56151278-56151300 GCGTGAGCCACCTCACCTGGCGG + Intergenic
974447694 4:62007655-62007677 GCATGAGGCCCCACATGTTGTGG - Intronic
974705510 4:65510323-65510345 GCATGAGCCACTACGCTCGGTGG + Intronic
974756698 4:66218594-66218616 GCATGAGCCACCATGTCTGGCGG + Intergenic
975872698 4:78798095-78798117 GCATGAGCCACTGCATTTGGCGG + Intronic
976270877 4:83229290-83229312 GCATGAGCCACCATGCCTGGCGG + Intergenic
976600255 4:86931753-86931775 GCGTGAGCCACCACACCTGGCGG - Intronic
977501572 4:97846344-97846366 GCATGAGCCACCACACCCAGTGG - Intronic
978355495 4:107868434-107868456 GCGAGAGCCACCACACCTGGCGG - Intronic
978356435 4:107879740-107879762 GCGTGAGCCACCGCACCTGGTGG + Intronic
978588490 4:110298819-110298841 GCATGAGCCACCACCCCTGGCGG + Intergenic
978607996 4:110503683-110503705 ACATCAGCCACCACAGTTGAGGG - Intronic
978836782 4:113160344-113160366 GCATGAGTCACCACATCCAGCGG + Intronic
978969644 4:114787487-114787509 GCATGAGCCACCACGCCCGGTGG + Intergenic
979242724 4:118462529-118462551 GCATGAGCCACCACTGTGGCTGG + Intergenic
979932876 4:126654202-126654224 GCATGAGCCACTACAGTTTTTGG - Intergenic
981634229 4:146857323-146857345 GTCTGAGCCACAACAGTTGGGGG + Intronic
982204471 4:152987272-152987294 GCATGAGCCACCGCACCTGGCGG + Intergenic
982745235 4:159099613-159099635 GCATGAGCCACCGCACTAGCTGG + Intergenic
982975166 4:162047547-162047569 GCATGAGCCACCGCACCTCGCGG - Intronic
983578064 4:169280197-169280219 GCATGAGCCACCGCGCCTGGTGG - Intergenic
983620988 4:169760663-169760685 GCATGAGCCGCCACACGCGGTGG - Intergenic
984762420 4:183374388-183374410 GTATGAGCCACCACAGCTGGCGG + Intergenic
984874347 4:184354080-184354102 GCATGAGCCACCACACCTGGCGG - Intergenic
984998362 4:185459943-185459965 GCTTGAGACATCACATTTGGAGG + Exonic
985040422 4:185886273-185886295 GCGTGAGCCACCGCACTGGGTGG - Intronic
985745986 5:1647964-1647986 GCATGAGCCACCACGCCCGGTGG - Intergenic
985994955 5:3592649-3592671 GCCTCAGCCACCCCCTTTGGAGG + Intergenic
986546668 5:8905327-8905349 ACAAGAACCAACACATTTGGTGG - Intergenic
986595822 5:9420732-9420754 GCATGAGCCACCATGCCTGGCGG - Intronic
987667243 5:20959253-20959275 GCATGAGCCACCACACCAGGTGG + Intergenic
987772761 5:22328128-22328150 GTGTGAGCCTCTACATTTGGTGG - Intronic
988160163 5:27508974-27508996 GCATGAGCCACCACATGTGGCGG + Intergenic
988437816 5:31195823-31195845 GCATGAACCATTACATTAGGTGG - Intronic
988729296 5:33954409-33954431 GCATCAGCCACCTCATTGGATGG - Exonic
989152582 5:38314970-38314992 TCATAAGCCACAATATTTGGGGG + Intronic
989576815 5:42995645-42995667 GTGTGAGCCACCACTTTGGGAGG + Intergenic
989643517 5:43604950-43604972 GCGTGAGCCACCACCCTGGGTGG + Intronic
989698334 5:44231610-44231632 GTGTGAGCCACCACACTCGGCGG - Intergenic
990949144 5:61279187-61279209 GCATGAGCCACAACACCTGGTGG - Intergenic
992047826 5:72914254-72914276 GCATGATCCAAAATATTTGGTGG - Exonic
992357530 5:76001318-76001340 GCATGAGCCACCGCGCCTGGCGG - Intergenic
992449417 5:76862516-76862538 GCGTGAGCCACCGCACCTGGTGG - Intronic
992535081 5:77692563-77692585 GCATGAGCCACTGCACCTGGCGG + Intronic
994199045 5:96951536-96951558 GCGTGAGCCACCGCACCTGGCGG + Intronic
994438636 5:99771504-99771526 TCATGAGTCACCACATGAGGTGG - Intergenic
996691781 5:126348009-126348031 GCATGAGCCACCACCGTTCCTGG + Intergenic
998102486 5:139445844-139445866 GCATGAGCCACCATGCCTGGCGG - Intergenic
998113937 5:139522438-139522460 GCCTGAGCTACCTCCTTTGGAGG - Intergenic
999307810 5:150531777-150531799 GCATGAGCCACTGCACCTGGCGG + Intronic
999308281 5:150534931-150534953 GCATGTGGCTCCACATGTGGGGG - Exonic
999583150 5:153062167-153062189 GCGTGAGCCACCACACCCGGTGG + Intergenic
1000192089 5:158920992-158921014 TCATCTGTCACCACATTTGGGGG + Intronic
1000540913 5:162538566-162538588 GCATGAGCCACCATGCCTGGCGG + Intergenic
1000694921 5:164368653-164368675 GCATGAGCCACCCCACCAGGAGG - Intergenic
1003327539 6:5103914-5103936 GTGTGAGCCACCACACCTGGAGG + Intronic
1004198301 6:13525390-13525412 ACGTGAGCCACCACATTAGCCGG - Intergenic
1005076186 6:21910096-21910118 ACATGAGCCACCACACCCGGTGG + Intergenic
1005383626 6:25263389-25263411 GCATGAGCCACCGCACCGGGCGG - Intergenic
1006540459 6:34735917-34735939 GCGTGAGCCACCATAACTGGCGG - Intergenic
1007332918 6:41128076-41128098 GCATGAGCCACCACACCCGGCGG + Intergenic
1007456817 6:41984626-41984648 GCATGAGCCACCACTCTCGGCGG + Intronic
1007554403 6:42753950-42753972 GCATGAGCCACTACACTTCATGG + Intronic
1007554412 6:42754010-42754032 GCATGAGCCACTACACTTCATGG + Intronic
1007554421 6:42754070-42754092 GCATGAGCCACTACACTTCATGG + Intronic
1008219112 6:48834445-48834467 GTGTGAGCCACCACACCTGGTGG - Intergenic
1008824816 6:55680975-55680997 TCATGGGACACCACATTTGCAGG + Intergenic
1009815248 6:68725029-68725051 GCACCACCAACCACATTTGGGGG + Intronic
1010433339 6:75802765-75802787 GCATGAGCCACTGCACCTGGTGG + Intronic
1012179132 6:96128975-96128997 GCATGAGCCACCACACCCGGTGG - Intronic
1012895838 6:104947402-104947424 GCATGAGCCACCACACCAGCTGG + Intergenic
1013083284 6:106831852-106831874 GCATGAGCCACCATGCCTGGTGG + Intergenic
1013302991 6:108821539-108821561 GCATGAGCCACCACACCTGGCGG + Intergenic
1013307663 6:108864525-108864547 GCATGAGCCACCACGCCTGGCGG + Intronic
1015560975 6:134515402-134515424 GCATGGGCCATGACATTTGTGGG + Intergenic
1015954664 6:138587251-138587273 GCGTGAGCCACCACACCTGGAGG + Intronic
1016012148 6:139148481-139148503 GCGTAAGCCACCACACCTGGCGG - Intronic
1016360291 6:143260298-143260320 GCATGAGCCACCGCATCTGGCGG + Intronic
1016448822 6:144159946-144159968 GCATGAGCCACCAAGCTGGGTGG - Intronic
1016781514 6:147964384-147964406 GCATGAGCCACCGTGTCTGGCGG + Intergenic
1016947391 6:149547217-149547239 GCTTGAGCCACCGCACCTGGCGG + Intergenic
1017219863 6:151953440-151953462 GCATGAGCCACCGCACTGGCCGG - Intronic
1017632659 6:156412585-156412607 GCATGAGCCACCGCGCCTGGTGG - Intergenic
1018405697 6:163479648-163479670 GCGTGAGCCACCACGCCTGGCGG + Intronic
1019982933 7:4634805-4634827 GCATGAGCCACCGCACCCGGTGG + Intergenic
1020058497 7:5135088-5135110 GCATGAGCCGCCTCACTGGGCGG + Intergenic
1020199020 7:6064763-6064785 GTGTGAGCCACCACACCTGGAGG + Intergenic
1020245822 7:6428765-6428787 GCATGAGCCACTGCACCTGGTGG + Intronic
1020298205 7:6774456-6774478 GCATGAGCCACTGCACCTGGCGG + Intronic
1021714865 7:23452521-23452543 GCATGAGCCACCACGCCTGGGGG - Intronic
1022718738 7:32923299-32923321 GCATGAGCCACTGCACCTGGCGG - Intergenic
1023178473 7:37456884-37456906 GCATGAGCCACCACACCCAGGGG - Intergenic
1023478982 7:40612850-40612872 GCATGAGCCACCGCATCTGGTGG - Intronic
1023909940 7:44546706-44546728 GCATGAGCCACTGCACCTGGCGG - Intergenic
1024805447 7:53134172-53134194 GCATGAGCCACCATATGGGCTGG - Intergenic
1025556974 7:62321399-62321421 GCATGAACCACCATATGTGCTGG - Intergenic
1025837733 7:65110928-65110950 GCATGAGCCACCATATGGGCTGG + Intergenic
1025885339 7:65585067-65585089 GCATGAGCCACCATATGGGCTGG - Intergenic
1026717214 7:72799743-72799765 GCATGAGCCACCGCACCTGCAGG + Intronic
1026805181 7:73424802-73424824 GCATGAGCCACCACGCCTGGCGG - Intergenic
1027123258 7:75537433-75537455 GCTGGAGCTACCACAGTTGGGGG + Exonic
1027748654 7:82111727-82111749 GCATGAGCCACCACACCAGGAGG + Intronic
1028933978 7:96445170-96445192 GTATGAGCCACCACACTTGGCGG + Intergenic
1030112661 7:106039778-106039800 GCATGGCCCACCTCATTTGCTGG + Intergenic
1030837709 7:114309943-114309965 GCATGAGCCACTGCACCTGGTGG + Intronic
1032311336 7:130790098-130790120 CCAGGTGCCACCACATATGGTGG - Intergenic
1032593879 7:133219480-133219502 GCCTGAGCCAACAAATATGGTGG - Intergenic
1032816591 7:135482273-135482295 GCATGAGCCACCACACTCCTAGG - Intronic
1032816947 7:135485348-135485370 GCTTGAGCCACCACAGCTGGCGG + Intronic
1033341051 7:140492595-140492617 GCATGAGCCACCACGCCCGGCGG - Intergenic
1033523652 7:142187755-142187777 GAATGAGCCATCAAATTTTGTGG + Intronic
1036093419 8:5695536-5695558 GCATGAGCCACCACATGGCCCGG - Intergenic
1036654678 8:10670596-10670618 GCGTGAGCCACCACACCTGATGG - Intronic
1037129130 8:15386175-15386197 GCGTGAGCCACCGCGTCTGGCGG + Intergenic
1037824105 8:22150636-22150658 GCGTGAGCCACCGCACCTGGCGG + Intronic
1038953402 8:32441471-32441493 GCATGCACCACCACACCTGGTGG - Intronic
1039027425 8:33272751-33272773 GAGTGAGCCACCACACCTGGCGG - Intergenic
1039361348 8:36880774-36880796 GCATCCACCTCCACATTTGGAGG + Intronic
1039451370 8:37677371-37677393 GCGTGAGCCACCACACCTGGAGG + Intergenic
1039696023 8:39912400-39912422 GCGTGAGCCACCACACCGGGGGG + Intronic
1039802768 8:40974381-40974403 GTTTGAGCCATTACATTTGGGGG - Intergenic
1040099563 8:43486201-43486223 GCATGAGCCACCACGCCTGGTGG - Intergenic
1040445004 8:47484536-47484558 GCATGAGCCACTGCATGAGGAGG - Intronic
1040890221 8:52309373-52309395 GCATGCGCCACCACACCTGGCGG - Intronic
1041165119 8:55084108-55084130 GTGTGAGCCACCACACCTGGTGG + Intergenic
1043052492 8:75401265-75401287 GCATGAGCCATCGCACTTGGCGG - Intergenic
1043124450 8:76372478-76372500 GCGTGAGCCACCACGCGTGGCGG + Intergenic
1045430185 8:102106352-102106374 GCGTGAGCCACCATACCTGGCGG + Intronic
1047405901 8:124585686-124585708 GCATGAGCCACCATGCCTGGCGG + Intronic
1047621040 8:126608380-126608402 GCGTGAGCCACTGCACTTGGCGG - Intergenic
1047710702 8:127549543-127549565 GCATGAACAAACATATTTGGAGG - Intergenic
1047790862 8:128202385-128202407 GCCTGAGACACCACAGTTGATGG + Intergenic
1047867431 8:129041926-129041948 GCGTGAGCCACCGCGCTTGGTGG + Intergenic
1049173031 8:141173870-141173892 GAATGAGCCACCTCATAAGGTGG + Intronic
1049820240 8:144629034-144629056 GTGTGAGCCAACACCTTTGGGGG - Intergenic
1049863246 8:144915685-144915707 GCATGAGCCACCACACTCAGTGG - Intergenic
1052588645 9:30462421-30462443 GCATGAGCCACCATGCATGGTGG - Intergenic
1052755846 9:32540003-32540025 GCATGAGCCACTGCACCTGGCGG - Intergenic
1052854563 9:33399118-33399140 GCATGAGCCACCACGCCTGGTGG + Intronic
1052911344 9:33884556-33884578 GCATGAGCCACCACTTTTTGTGG + Intronic
1052962579 9:34312977-34312999 GCGTGAGCCACCACACTGGCTGG + Intronic
1053347595 9:37389225-37389247 GGATGAGAGTCCACATTTGGTGG - Intergenic
1055139731 9:72862686-72862708 GCATGAGCCACCATACAGGGTGG - Intergenic
1055299473 9:74868212-74868234 GCGTGAGCCACCACACCCGGCGG - Intronic
1055484060 9:76739803-76739825 GCATGAGCCACCGCGCCTGGTGG - Intronic
1055595745 9:77862896-77862918 GCATGAGCCACCGTGTCTGGCGG - Intronic
1055697943 9:78908488-78908510 GCATTAGCCACTAAATTTGCAGG + Intergenic
1056290553 9:85139597-85139619 GCATGAGCCACCATGCCTGGCGG - Intergenic
1056691487 9:88812105-88812127 GCATGAGCCACCGCACCCGGCGG + Intergenic
1057057970 9:91978388-91978410 GCATGAGCCACCCCACCTGCCGG + Intergenic
1057615283 9:96583996-96584018 GCATGAGCCACCGCGCCTGGCGG + Intronic
1058822820 9:108748110-108748132 GCATGAGCCACCGCGCCTGGTGG - Intergenic
1058998598 9:110324829-110324851 GCATGTGCCACCGCACTTGGTGG - Intronic
1059051356 9:110930234-110930256 GCGTGAGCCACCACGTCCGGTGG - Intronic
1059478419 9:114568576-114568598 GCGTGAGCCACCACGCCTGGTGG - Intergenic
1059703952 9:116802364-116802386 GCATGAGCCACCACAACCAGCGG + Intronic
1059971939 9:119677171-119677193 GCATGAGCTACTGCACTTGGCGG + Intergenic
1060891923 9:127194556-127194578 GCATGCGCCACCACACCCGGTGG + Intronic
1061613507 9:131763904-131763926 GTATGAGCCACCGCACCTGGTGG - Intergenic
1061831058 9:133295151-133295173 GCGTGAGCCACCACGCCTGGTGG - Intergenic
1062196826 9:135278950-135278972 GCATGAGCCACCACGCCTGGCGG - Intergenic
1203761319 EBV:13886-13908 GCCTGAGCCTCTACTTTTGGGGG - Intergenic
1203762248 EBV:16958-16980 GCCTGAGCCTCTACTTTTGGGGG - Intergenic
1203763177 EBV:20030-20052 GCCTGAGCCTCTACTTTTGGGGG - Intergenic
1203764106 EBV:23102-23124 GCCTGAGCCTCTACTTTTGGGGG - Intergenic
1203765035 EBV:26174-26196 GCCTGAGCCTCTACTTTTGGGGG - Intergenic
1203765964 EBV:29246-29268 GCCTGAGCCTCTACTTTTGGGGG - Intergenic
1203766893 EBV:32318-32340 GCCTGAGCCTCTACTTTTGGGGG - Intergenic
1203581556 Un_KI270746v1:10973-10995 GCATGAGCCACCATATGGGCTGG + Intergenic
1185790819 X:2927571-2927593 GCATGAGCCACCTCGCCTGGCGG + Intronic
1186549440 X:10487138-10487160 GCATGAGCCACCACACCTGGTGG + Intronic
1186777955 X:12884258-12884280 GCATGAGCCACCACATCTGGTGG + Intronic
1187342182 X:18431141-18431163 GCATGAGCCACCGCACCTGGCGG + Intronic
1187350899 X:18516131-18516153 GCATGAGCCACCACCATGCGTGG + Intronic
1187410158 X:19044271-19044293 GCATGAGCCAAGAAATGTGGGGG - Intronic
1187477308 X:19623403-19623425 GCATCAGCCACCACGCCTGGCGG - Intronic
1187908986 X:24093213-24093235 GCATGAGCCACCGCGCCTGGCGG - Intergenic
1188843393 X:35043744-35043766 GCATGCACCACCACACCTGGCGG - Intergenic
1189223105 X:39389521-39389543 GCTTGAGCCACCATACCTGGTGG - Intergenic
1189305999 X:39987082-39987104 GCGTGAGCCACCACTCCTGGCGG + Intergenic
1189401536 X:40674001-40674023 GGATGAGCCACATCCTTTGGGGG - Intronic
1189561036 X:42191672-42191694 GCATGAGCCACCGCCACTGGAGG + Intergenic
1189919264 X:45887441-45887463 GCGTGAGCCACTGCATCTGGTGG + Intergenic
1190638547 X:52460379-52460401 GCATGAGCCACCTCCCTTGCTGG + Intergenic
1190678107 X:52800048-52800070 GCATGAGCCACCTCCCTTGCTGG - Intergenic
1191152933 X:57240665-57240687 GCATGTGCCAGCACATCTGTAGG + Intergenic
1192429931 X:71104931-71104953 GCGTGAGCCACCGCATCTGGCGG - Intronic
1194151658 X:90332474-90332496 ACATGTGAGACCACATTTGGGGG - Intergenic
1194550782 X:95296273-95296295 GCATGAGCCACCACGCCTGGTGG - Intergenic
1195135148 X:101898768-101898790 GCGTGAGCCACCACGTCTGGCGG - Intronic
1195281752 X:103342502-103342524 GTATGATCCACCACATCTGATGG - Intergenic
1195377446 X:104241582-104241604 GCATGAGCCACCGCGCCTGGCGG - Intergenic
1196212428 X:113010844-113010866 GCATGAGCCACTGCACCTGGTGG + Intergenic
1196670134 X:118357599-118357621 GCATGAGCCACCACACCTGGTGG - Intronic
1196851061 X:119939616-119939638 GCATGTGCCACCGCACCTGGCGG - Intronic
1197333293 X:125180393-125180415 GCATGACCCACCACACCTGGTGG - Intergenic
1197748015 X:129945958-129945980 GCATGAGCCACTGCACCTGGCGG + Intergenic
1198531657 X:137554245-137554267 GCATGAGCCACCACACCCAGCGG + Intergenic
1198569945 X:137944319-137944341 GCATGAGCCACCCTACTTGGTGG - Intergenic
1198927212 X:141812284-141812306 GCATGAGCCACTGCACCTGGTGG + Intergenic
1199177816 X:144812097-144812119 GCGTGAGCCACCGCACCTGGTGG - Intergenic
1200255191 X:154577701-154577723 GCATGAGCCACCATGCCTGGTGG + Intergenic
1200262578 X:154626703-154626725 GCATGAGCCACCATGCCTGGTGG - Intergenic
1200498022 Y:3909242-3909264 ACATGTGAGACCACATTTGGGGG - Intergenic
1201273157 Y:12275426-12275448 GCATGAACCACCACTCTCGGAGG - Intergenic
1201303503 Y:12531027-12531049 GCATGAGCCACCATGCCTGGTGG + Intergenic
1201354325 Y:13081950-13081972 GCGTGAGCCACCACGTTTTGTGG + Intergenic