ID: 1165474613

View in Genome Browser
Species Human (GRCh38)
Location 19:36023354-36023376
Sequence ATGGAGACCCAGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 709}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165474613_1165474619 14 Left 1165474613 19:36023354-36023376 CCTTCCTGCCTCTGGGTCTCCAT 0: 1
1: 0
2: 5
3: 80
4: 709
Right 1165474619 19:36023391-36023413 CTGCTTCCTTATCTTTGCAAAGG 0: 1
1: 0
2: 7
3: 90
4: 924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165474613 Original CRISPR ATGGAGACCCAGAGGCAGGA AGG (reversed) Intronic
900158669 1:1213351-1213373 ATGGAGACCCTGCCGCAGGCGGG - Intronic
900369033 1:2323355-2323377 CTGGAGAGCCAAAGGCTGGAAGG - Intronic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
900602174 1:3507629-3507651 CTGGAGACAGGGAGGCAGGAAGG + Intronic
900804190 1:4756596-4756618 ATGTAGTCTCAGAGACAGGAGGG - Intronic
900908621 1:5578274-5578296 ATAGAGACAGAGAGACAGGAGGG - Intergenic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902408451 1:16199276-16199298 AGGGAGTCCCAAGGGCAGGATGG + Intronic
902531542 1:17093876-17093898 ATAGAGGCACAGAGACAGGAAGG + Intronic
902919722 1:19658510-19658532 AGCGAGGCCCAGAGGCAGCAGGG + Intergenic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903789742 1:25884729-25884751 ATGGAGACCCAGAGAAATAAAGG + Intronic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
903930345 1:26858359-26858381 ATTGAAGCCCAGAGGCAGGAAGG + Intergenic
904293705 1:29504191-29504213 TTGGCTGCCCAGAGGCAGGAGGG - Intergenic
904293713 1:29504220-29504242 ATGGAGACCCAGAGACAACAGGG - Intergenic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
904710087 1:32423707-32423729 AAGGAGACCCAAAGTCAGGCGGG + Intergenic
905491718 1:38349415-38349437 ATGGAAAGCTAGAGTCAGGAAGG - Intergenic
905688629 1:39926755-39926777 ACGAAGGCCCAGAGGCAAGAAGG - Intergenic
906471792 1:46137066-46137088 ATTGAGACCCAGAGCAATGAGGG + Intronic
906679033 1:47712464-47712486 ATGGAGAAACCAAGGCAGGAAGG - Intergenic
906699691 1:47848944-47848966 ATGGGGACCCACAGGGATGAAGG - Intronic
906835252 1:49076414-49076436 ATGCAGAACCAGAGACAGGGAGG + Intronic
907192862 1:52663252-52663274 ACTGAGACCCAGAGGCGTGAGGG + Intronic
907358836 1:53898281-53898303 GTGGGGTCCCAGAGGCAGGAAGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907451196 1:54547025-54547047 AGGGAGGCCCAGAGAAAGGAGGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
908496053 1:64696075-64696097 GTGGAAATCCAGAGGTAGGATGG - Intergenic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
908606912 1:65808054-65808076 ATCTAGTCCCAGAGACAGGATGG + Intronic
910841965 1:91569766-91569788 AAGGAGAGCCACAGGAAGGAAGG + Intergenic
911118776 1:94274199-94274221 ATGAAGACCCAGAGACTGTAAGG - Intronic
912196412 1:107402293-107402315 AGGCTGACCCTGAGGCAGGATGG - Intronic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912703440 1:111895172-111895194 AGGGAGACCAAGAGCAAGGAGGG + Intronic
912977597 1:114344656-114344678 AGTGAGACCCAGAGGTAGGGAGG + Intergenic
913387675 1:118277644-118277666 AAGAGGACCTAGAGGCAGGAGGG - Intergenic
913661951 1:121012422-121012444 ACAGAGAACCTGAGGCAGGAGGG - Intergenic
913995784 1:143651335-143651357 ACAGAGACCCTGAGGCAGGAGGG - Intergenic
914013328 1:143795607-143795629 ACAGAGAACCTGAGGCAGGAGGG - Intergenic
914164497 1:145165578-145165600 ACAGAGAACCTGAGGCAGGAGGG + Intergenic
914474721 1:148013732-148013754 ACAGAGACCCTGAGGCAGGAGGG - Intergenic
914651950 1:149704216-149704238 ACAGAGAACCTGAGGCAGGAGGG - Exonic
914802353 1:150970961-150970983 TTGGATACCCAGAGGAGGGAGGG + Intronic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915477081 1:156159479-156159501 GTGGAGAGACAGAGGCACGAGGG + Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916481312 1:165217260-165217282 TCAGAGCCCCAGAGGCAGGATGG + Intronic
916575450 1:166063040-166063062 ATGGAGCCCCTGGGCCAGGAAGG + Intronic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916723326 1:167501746-167501768 AAGGAGACCAGAAGGCAGGAGGG + Intronic
917691878 1:177478098-177478120 AATGAGACCCATAGGCTGGAAGG - Intergenic
917808920 1:178638600-178638622 CTGGAGACCTAAAGGAAGGAAGG - Intergenic
917929168 1:179812186-179812208 ATTGGGACCAAGGGGCAGGAGGG - Intronic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
919795234 1:201317692-201317714 CTGGAGACCCGGAGGCAGAATGG + Exonic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920292725 1:204935361-204935383 ACAGAGACTCAGAGGCAGGCAGG + Intronic
921047133 1:211485486-211485508 ACAGAGACAGAGAGGCAGGAGGG + Intronic
921562126 1:216671479-216671501 TGGGATACCCAGAGGCTGGATGG - Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922901722 1:229142427-229142449 AATGAGACTGAGAGGCAGGAGGG - Intergenic
923097741 1:230788865-230788887 ATGGAGATCCAGAGTTTGGAAGG + Intronic
1063044100 10:2373887-2373909 AAGGAGAGACAGAGGCTGGAAGG - Intergenic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1065293393 10:24253103-24253125 GCTGAGACCCAGAGGAAGGAAGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066502087 10:36004000-36004022 ATGCAGAGCCCCAGGCAGGAGGG + Intergenic
1066779182 10:38924645-38924667 ATGAAGACCCAGACACAAGATGG + Intergenic
1067308850 10:45093321-45093343 TGGGACACCCAGAGGCAGAAAGG - Intergenic
1067517393 10:46963419-46963441 ATGGAAGCCCAGAGATAGGAAGG + Intronic
1067644855 10:48088410-48088432 ATGGAAGCCCAGAGATAGGAAGG - Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1068942041 10:62689959-62689981 AGTGAGACCCAGGGGAAGGAAGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069508606 10:69023273-69023295 AGCGAGATCCAGACGCAGGATGG - Intergenic
1069634988 10:69919663-69919685 AGGGAGACCCAGGAGCAGAAGGG + Intronic
1069756481 10:70776975-70776997 ATGGAAACCTAGAGGCAGCAGGG + Intronic
1069799109 10:71071306-71071328 AAGGAAGCCCATAGGCAGGAAGG + Intergenic
1069923787 10:71834066-71834088 ACAGAGGCCCAGAGGCAGCATGG + Intronic
1069989969 10:72309222-72309244 ATGGAGAGTAAGCGGCAGGAAGG + Intergenic
1070410150 10:76132239-76132261 TTGGAGCCCAAGAAGCAGGAAGG + Intronic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1072727253 10:97822175-97822197 ATGGAAAGCTAGAGGCAGGAAGG - Intergenic
1072872214 10:99132585-99132607 ATGGAGAGCAAGACGAAGGAGGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073026147 10:100488624-100488646 ATTGAGACCTAAAGGCAGCAGGG - Intronic
1073043622 10:100623537-100623559 ATGGAGAAAGACAGGCAGGAAGG + Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075663785 10:124216522-124216544 AGCGAGGCACAGAGGCAGGAAGG + Intergenic
1075765262 10:124887844-124887866 ATGAAGACGCAGAGGAAGGGAGG + Intergenic
1075785980 10:125050461-125050483 ACGGAAACCCAGAGGGATGAAGG + Intronic
1075885617 10:125896643-125896665 ATGGAGCCCCAGAGTAAGGGAGG + Exonic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1077194009 11:1270355-1270377 AAGGACCCACAGAGGCAGGATGG - Intergenic
1077201338 11:1309132-1309154 ATGGTGCCCCAGAGGGAGGCAGG - Intronic
1077208800 11:1358503-1358525 CTGGAGAGCCATAGCCAGGAGGG - Intergenic
1077401991 11:2363465-2363487 TGGGAGCCCCAGAGGCTGGAGGG - Intergenic
1077406191 11:2383519-2383541 AGTGAGGCCCTGAGGCAGGAAGG - Intronic
1077532518 11:3103867-3103889 ATGGGGCTACAGAGGCAGGAAGG - Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1078101420 11:8332458-8332480 TTGGAGACCCATAGGCAGGCAGG - Intergenic
1079130323 11:17743553-17743575 ATGGAGTCCCAGGGGCTGCATGG - Intronic
1079239399 11:18712014-18712036 ATGGAGACCTTAAGCCAGGAAGG - Intronic
1079343083 11:19629126-19629148 ATGGAGACACTGAGGCAGAGCGG - Intronic
1079469596 11:20765624-20765646 CCGGAGACCCTAAGGCAGGAAGG + Intronic
1079490506 11:20983921-20983943 ATGGAGACAAAGAGGCAGCATGG - Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083599799 11:63939500-63939522 ATTGAGGCCCAGAGGAAAGAAGG + Intronic
1083716362 11:64579363-64579385 ATAGAGACACACAGGCAGGTGGG - Intergenic
1083901374 11:65645129-65645151 AGTGAGGCCCAGGGGCAGGAGGG + Exonic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084956325 11:72693549-72693571 ATGGAGAGGCTGGGGCAGGATGG - Intronic
1085416128 11:76320186-76320208 ATGGGGACCCAGAGGAAGATGGG - Intergenic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1086160587 11:83718026-83718048 ATGGACCCCCAGAGGGAGTACGG - Intronic
1088246629 11:107824769-107824791 AGGGCGAGCCAGAGGAAGGAAGG - Intronic
1088584030 11:111344220-111344242 TTGAAGACCAAGAGGCAGGCCGG - Intergenic
1088783234 11:113156363-113156385 ATGGTGACCCAAAGACAGCAAGG + Intronic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089126705 11:116181290-116181312 ATGGAGTCACACAGGCAGGAAGG + Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1090168463 11:124576996-124577018 GTAGAGACTCATAGGCAGGAAGG + Intergenic
1090424200 11:126595694-126595716 AGGGAGACCCAGTGGCCAGAAGG + Intronic
1091198293 11:133750378-133750400 ATTGAAGACCAGAGGCAGGAAGG + Intergenic
1091399389 12:173160-173182 AGGGATCCCCAGAGGCAGGTGGG + Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1091712760 12:2753319-2753341 CTGGACACCAAGAGACAGGAAGG - Intergenic
1091745449 12:2989180-2989202 TGGGAGGCCGAGAGGCAGGAGGG - Intronic
1092234198 12:6795905-6795927 GTGGAGAGCCACAGACAGGATGG + Intronic
1092650680 12:10631557-10631579 ATTGTAACCCAGAGGAAGGAAGG - Intronic
1094301088 12:28966183-28966205 ATGAAGCCCCAGGGGCAGGGGGG + Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1095965254 12:47863182-47863204 ATGGGGACCAGGAGGCAGGTAGG + Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098460797 12:70731043-70731065 AAGGAGACAGAGAGGAAGGAAGG + Intronic
1098477499 12:70921659-70921681 ATAAAGACACAGAGGCAGAAAGG - Intergenic
1100473881 12:94917900-94917922 ATTGAGACACTGAGGCAGGAGGG + Intronic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101439157 12:104690300-104690322 ACAGAGACCCAGAGACAGGAAGG - Intronic
1102016299 12:109650137-109650159 ACAGAGGCCCTGAGGCAGGAAGG + Intergenic
1102566041 12:113798131-113798153 ATGGAGACCCCGGCCCAGGAAGG - Intergenic
1103040542 12:117691617-117691639 ATGGAGAACTGGAGGCAGGAGGG - Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103620397 12:122183719-122183741 CTGGAGACAGGGAGGCAGGATGG - Intronic
1103663457 12:122541324-122541346 AGGGAGAGACAGAGGAAGGACGG - Intronic
1103744774 12:123115048-123115070 ATGGAGACCCAGCCTCAGAAGGG - Intronic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105232894 13:18516205-18516227 ATGAAGACCCAGACACACGATGG + Intergenic
1105717858 13:23085049-23085071 ATGAGGAGCCAGAGACAGGAGGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106442694 13:29791653-29791675 ATGGAAACTCTGAGGAAGGAAGG - Intronic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1107646554 13:42500007-42500029 GTGGAGACAGAGAGGCAAGACGG - Intergenic
1107773535 13:43813449-43813471 ATGGAGACTCAGAGGCTGGGTGG - Intergenic
1108044648 13:46372180-46372202 AGGGAGTCCCCGAGGCACGAAGG + Exonic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1110846445 13:80195308-80195330 ATAGAAACCCAGAAGCAAGAAGG - Intergenic
1112431355 13:99353455-99353477 ATGAAGACACCAAGGCAGGATGG - Intronic
1113107674 13:106789043-106789065 ATAAAGCCCCAGAGGCAGGATGG + Intergenic
1113437583 13:110306009-110306031 ATGCAGTCCCACAGGCCGGAAGG - Intronic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1113775528 13:112943037-112943059 ATGGAAATGCAGAGCCAGGAAGG + Intronic
1114205080 14:20563404-20563426 ATAAGGACCCAGAGGAAGGAAGG - Intergenic
1114530513 14:23392691-23392713 AATGAGCCCCAGAGGAAGGAAGG - Intronic
1114842573 14:26282465-26282487 ATGGAGACGGAGAGGGAGTAGGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116142921 14:41023104-41023126 ATGGTGACTCAGAGGAATGAGGG - Intergenic
1116231680 14:42226444-42226466 ATGGACCACCAGTGGCAGGAGGG - Intergenic
1119046142 14:71320591-71320613 AGGGAGCCACAGAGGCGGGAGGG - Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121515606 14:94547917-94547939 ATTGCAACCCAGGGGCAGGATGG + Intergenic
1121525215 14:94614695-94614717 ATGGGCCCCCAGAGACAGGAAGG - Exonic
1121742851 14:96266255-96266277 AAGTAGGCCCAGAGGCAGGTGGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121979508 14:98442485-98442507 ATTGAGACCCAGAAGAACGATGG + Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122130532 14:99602636-99602658 CTTGAGACCCAGAGGCAGTTGGG - Intronic
1122138292 14:99647049-99647071 AGGAAGACTCAGAGGCAGGCAGG + Intronic
1122196016 14:100086501-100086523 AGGGCAACCAAGAGGCAGGAAGG - Intronic
1122319215 14:100843685-100843707 ATAGAGAGGCAGAGGCAGCAGGG + Intergenic
1122533157 14:102443163-102443185 ATGGAGGCCCAAAGGCTGCAGGG - Intronic
1122631577 14:103109702-103109724 AGGGAGACCCAGGGACAGGGTGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123181848 14:106478762-106478784 ATGTAAACCCAGAAGCATGAGGG + Intergenic
1202902630 14_GL000194v1_random:52265-52287 ATGCAGACCCAGACCCTGGAGGG - Intergenic
1202872451 14_GL000225v1_random:177297-177319 ATGGAGCCCCAGAGTAAGGGAGG - Intergenic
1202945056 14_KI270726v1_random:17967-17989 ATGTAAACCCAGAAGCATGAGGG - Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124391910 15:29267007-29267029 AAGGGGACCAGGAGGCAGGAAGG + Intronic
1124700939 15:31911293-31911315 GTGGACTCCTAGAGGCAGGAGGG + Intergenic
1124716554 15:32068293-32068315 AGTGAGACCCTGAGGAAGGAAGG + Intronic
1125234529 15:37497661-37497683 AAAGAGCCCCAGAGGAAGGAGGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1127798166 15:62455733-62455755 ATGGAGTCCCAGAGGCAAAAGGG - Intronic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128108662 15:65062469-65062491 ATGGAGACCCTCAGGCACAAAGG - Intronic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128700346 15:69799422-69799444 AGGGAGACTCAGAGTCAGGGAGG + Intergenic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129670572 15:77605695-77605717 AGGGTCATCCAGAGGCAGGAGGG - Intergenic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130907158 15:88248970-88248992 ATTGAGACCCAGAGGAGGAAAGG + Intronic
1131116630 15:89799986-89800008 AGGGGGACCCACAGGGAGGAAGG - Intronic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1131384295 15:91990530-91990552 AGGAACACCCAGAGGCAAGAGGG - Intronic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132279181 15:100598001-100598023 ATCAAGGCCCAGAGGCTGGAAGG - Intronic
1132502751 16:291860-291882 GTGAAGGCCCAGAGGCAGGTTGG - Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132645115 16:995607-995629 CAGGAGACCCACTGGCAGGAAGG + Intergenic
1132793413 16:1706343-1706365 ATGGAGATCCAGATGGACGAGGG + Exonic
1133946079 16:10349703-10349725 ATGGAGACACATAGTCAAGAAGG + Intronic
1134636114 16:15793305-15793327 AGCAAGACCCAGAGACAGGAAGG - Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1139987032 16:70907186-70907208 CTGGACACCCAGAGGAATGAGGG - Intronic
1140470243 16:75209701-75209723 ATGGAGTCCCAGATCCAGGCTGG + Intergenic
1140721159 16:77773514-77773536 CTTGAGTCCCAGAGGTAGGAAGG + Intergenic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141231374 16:82170485-82170507 AGGGAGTCCCCGAGGGAGGATGG - Intergenic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141364078 16:83426193-83426215 GTGGAAACCCAGAGGCTGGGAGG - Intronic
1141945210 16:87304995-87305017 ATGCAGGCCCCCAGGCAGGAAGG + Intronic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1142960118 17:3547376-3547398 TTTGAGAGCTAGAGGCAGGAGGG + Intronic
1143029879 17:3961978-3962000 ATGGCAAGCCTGAGGCAGGAAGG + Intronic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1144391701 17:14799434-14799456 ATGAAGAGCCAGAGACAGGTGGG + Intergenic
1145708479 17:26945313-26945335 ATGGAGACCCAGACACAAGATGG + Intergenic
1145821686 17:27841752-27841774 ATGGAGCCCCAGTGGAAGCAAGG - Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146173959 17:30653008-30653030 ATGGGGACCCAGTGGAAGGTGGG + Intergenic
1146347415 17:32069030-32069052 ATGGGGACCCAGTGGAAGGTGGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146496292 17:33325429-33325451 ATGGAGATCTTGAGGCAGAAAGG + Intronic
1146952034 17:36913478-36913500 AGGGAGAGCCAGGGGCAGAAGGG - Intergenic
1147159068 17:38560202-38560224 ATGGAGTCCCAGAGAAGGGAAGG + Intronic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG + Intronic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1148240230 17:45995572-45995594 AAGGACACCCAGAGGAGGGAGGG + Intronic
1148427906 17:47616148-47616170 ACTGAGACCCAGAGGGATGAAGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148555305 17:48575593-48575615 AAGCAGCCCCAGAGGTAGGAAGG + Exonic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1148866828 17:50633156-50633178 ATGAAGTCCCAGAGGCATCAAGG + Intergenic
1148867414 17:50635654-50635676 AGGGAGGCCCAGAGAGAGGAAGG + Intronic
1148875978 17:50687474-50687496 AATGAGGCCCAGAGGCAGGTGGG + Intronic
1149568171 17:57653861-57653883 ATGGACTCCCAGAGCCAGGTGGG + Intronic
1149571958 17:57678404-57678426 TTGGGGACCCAGAGGAAGTAAGG + Intronic
1150148155 17:62788327-62788349 AGGGAGAGCCAGGGGCAGGAAGG - Intronic
1150715971 17:67572872-67572894 ACAGAGACCCAGAGGGAAGAAGG + Intronic
1151279933 17:73065882-73065904 AGGGAGGCTCAGAGGCAGGACGG + Intronic
1151341203 17:73472080-73472102 ATGGGGACCCAGGGGCAGGGGGG - Intronic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152703724 17:81832618-81832640 ACGGCTACCCAGGGGCAGGAGGG + Intronic
1154314107 18:13290252-13290274 ATGGAAAACCAGGGACAGGAAGG - Intronic
1154520409 18:15222247-15222269 ATGAAGACCCAGACACACGATGG - Intergenic
1155161777 18:23201968-23201990 ATGGAGACGCTGAGGCGGAAGGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155787985 18:29926116-29926138 ATGGAGTCTTAGAGGCAAGAGGG + Intergenic
1155791119 18:29971837-29971859 AAGAAGACACAGAGGCAGGCTGG - Intergenic
1156310576 18:35918543-35918565 GTGGAGACCCAGAGGAGGGAAGG - Intergenic
1156508279 18:37613051-37613073 AAGGAGACCCAGGAGCAGGCTGG - Intergenic
1157227551 18:45880674-45880696 ACCAAGACCCAGAGGCAGCATGG + Intronic
1157551124 18:48582505-48582527 GAGGGGACCCTGAGGCAGGAGGG - Intronic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159128109 18:64248287-64248309 TTGGAGACCAACAGACAGGAAGG - Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1160055642 18:75477381-75477403 AAGGACACCAAGAGGCAGAATGG + Intergenic
1160231927 18:77055240-77055262 GCAGAAACCCAGAGGCAGGAAGG + Intronic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160702277 19:513389-513411 ACTGAGGCCCAGAGGCAGGAGGG - Intronic
1160963918 19:1737253-1737275 ATGGCGACGGGGAGGCAGGAAGG + Intergenic
1161115187 19:2492875-2492897 ACCGAGGCCCAGAGACAGGAAGG + Intergenic
1161195382 19:2983535-2983557 GTGAAGGCCCTGAGGCAGGACGG + Intronic
1161296294 19:3522245-3522267 ATGCACAGCCCGAGGCAGGAAGG - Intronic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1161893625 19:7063360-7063382 ATGGAAACCCAGAGACAGTTTGG - Intergenic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1162536792 19:11267319-11267341 GGGGAGACCCAGGGGCTGGAGGG - Intergenic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1162876413 19:13624029-13624051 AGGGTGGCCCAGAGACAGGAGGG + Intergenic
1162988454 19:14287028-14287050 ATGGGGACCCAGTGGAAGGTGGG - Intergenic
1163006651 19:14401273-14401295 CTGGAGACCCACAGGCACAAGGG - Intronic
1163343931 19:16727692-16727714 ATGGGGGCTCAGAGGCAGGTTGG + Intronic
1163421770 19:17217522-17217544 ATGGAGGCCCCGGGGCAGCAAGG - Intronic
1163475718 19:17525069-17525091 AGGGAGCCCCTGAGGCAGGCGGG - Intronic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1163814058 19:19453024-19453046 AGGGATGCCCAGTGGCAGGAAGG - Intronic
1164535222 19:29081003-29081025 ATGGAGAGCCTGAGACTGGAAGG + Intergenic
1164727608 19:30476827-30476849 CTGGAGTCCAAGAGGCAGGCAGG - Intronic
1164728608 19:30483920-30483942 ACAGAGACCCAGAGGAATGATGG - Intronic
1164903282 19:31946469-31946491 ATGGAGAGACTGAGGCAGAAAGG + Intergenic
1164930566 19:32172591-32172613 ATGGGGCCCCAGATGAAGGAAGG - Intergenic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1166274738 19:41745195-41745217 ACCAAAACCCAGAGGCAGGAAGG + Intronic
1166279731 19:41783780-41783802 ACCAAAACCCAGAGGCAGGAAGG + Intergenic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1166397541 19:42452833-42452855 ACCAAAACCCAGAGGCAGGAAGG - Intergenic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167175793 19:47863604-47863626 GGGGAGACCCAGGGCCAGGATGG - Intergenic
1167315764 19:48761966-48761988 ACAGAGACCCAGAGGAAGGGGGG + Intergenic
1167359165 19:49020700-49020722 ATGGAGACTCAAAGATAGGAGGG + Intergenic
1167413945 19:49360877-49360899 ATAGAGACCCAGAGACAGAGGGG + Intronic
1167439410 19:49499831-49499853 AAGGAGACCCAGGGGAAGGCAGG - Intergenic
1167459136 19:49615190-49615212 ATAGAGACCCAGAGACAGGAGGG + Intronic
1167459172 19:49615364-49615386 ACAGAGACCCAGAGACGGGAGGG + Intronic
1167690232 19:50980568-50980590 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690267 19:50980710-50980732 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167740607 19:51322918-51322940 ACAGAGACCCAGAGGCAGAGGGG - Intronic
1167752699 19:51390424-51390446 ACAGAGACCCAGAGAGAGGAGGG - Intronic
1167791941 19:51688678-51688700 ACAGAGACACAGAGACAGGAAGG + Intergenic
1167972215 19:53195215-53195237 TTTGAGAGCCTGAGGCAGGAGGG + Intergenic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925157402 2:1658375-1658397 ATTGAGACCCAGAGACAGCTGGG - Intronic
925251227 2:2440580-2440602 ATGGAGTTCCACAGGCATGAAGG - Intergenic
925701808 2:6646423-6646445 ATGGAGTCCCAGAGAGGGGATGG - Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926397143 2:12454958-12454980 ATGGAAAGCCAGAGCCATGAAGG + Intergenic
926781568 2:16477405-16477427 ATGGAGACCAAGAAGCGAGATGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927275962 2:21262726-21262748 AATGAGACCTGGAGGCAGGATGG - Intergenic
927350362 2:22105503-22105525 ACAGAGACACAGAGGAAGGAAGG + Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
927862891 2:26571126-26571148 CTGGAGACCCAGAGGTAGAGAGG + Intronic
928194139 2:29202156-29202178 GTGAACAGCCAGAGGCAGGAAGG - Intronic
929871191 2:45760774-45760796 GTGGGAACCCAGGGGCAGGAGGG - Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930261659 2:49154091-49154113 TTGGAAAGCCACAGGCAGGAGGG + Intronic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
931055212 2:58461767-58461789 ATGAAGACCCAGCTGCACGAAGG - Intergenic
932741193 2:74292334-74292356 ATGGAGGGCCAGAGGTAGCATGG - Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933936422 2:87207518-87207540 ATGCAGACTAAGAGGCAAGATGG - Intergenic
934136571 2:89001457-89001479 ATGGAGACCCAGAAGCTAGTAGG - Intergenic
934143448 2:89070530-89070552 AAGGAGACTCAGTGGCAGGTAGG - Intergenic
934225790 2:90130025-90130047 AAGGAGACTCAGTGGCAGGTAGG + Intergenic
934504037 2:94878127-94878149 ATGCAGACCCAGACCCTGGAGGG + Intergenic
934812329 2:97291030-97291052 ATGAAGGCTCAGAGGCTGGAGGG + Intergenic
934825365 2:97416893-97416915 ATGAAGGCTCAGAGGCTGGAGGG - Intergenic
934858402 2:97743216-97743238 GTGGAGAGCCAGAGGTGGGAGGG - Intergenic
935409258 2:102741788-102741810 AGGGACACCCAAAGGCAAGAGGG + Intronic
935555843 2:104508744-104508766 ATGGGGACCCACATGGAGGAAGG + Intergenic
936068373 2:109349111-109349133 ATGGCCTCTCAGAGGCAGGAAGG - Intronic
936234106 2:110728916-110728938 ATAGAGACCCACAGAAAGGAAGG + Intergenic
936356727 2:111758311-111758333 ATGCAGACTAAGAGGCAAGATGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936399519 2:112154863-112154885 ATTGAGACTCAGAGACAGGCCGG + Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937064432 2:119006514-119006536 AAGGAGACCCAGAGCAAGGATGG + Intergenic
937256633 2:120560590-120560612 AGGGAGATCCAGAGCAAGGATGG - Intergenic
937368296 2:121280928-121280950 ATGAAGACACTGAGGCTGGAGGG + Intronic
938066036 2:128282575-128282597 GCAGAGACCCCGAGGCAGGAGGG + Intronic
938519760 2:132056022-132056044 ATGAAGACCCAGACACACGATGG - Intergenic
939637260 2:144597493-144597515 ATGTAGACAGGGAGGCAGGATGG + Intergenic
940251173 2:151678659-151678681 AGGGAGACCCAGAGCCAGGAGGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
942314951 2:174689681-174689703 ATGGTGACCCAGTGGAATGAGGG + Intergenic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942926361 2:181437806-181437828 AGGCAGACCCACAGGGAGGAAGG + Intergenic
943784476 2:191861913-191861935 GTGTAGACCAGGAGGCAGGAGGG - Intergenic
943902838 2:193463289-193463311 ATTCAGACCCTTAGGCAGGACGG - Intergenic
944366665 2:198928954-198928976 CTGGAGCCCATGAGGCAGGAGGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946647294 2:221851535-221851557 ATGGAGCCACAGAGGTGGGACGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947529235 2:230898324-230898346 ACAGAGACCGAAAGGCAGGAAGG + Intergenic
948012568 2:234661712-234661734 ACAGAGACCCTGAAGCAGGAAGG + Intergenic
948917461 2:241042129-241042151 ATGGTGCTCCTGAGGCAGGAGGG + Intronic
1168835292 20:873619-873641 ATGGGGGCCCAGAGGAAGGGAGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169332765 20:4729744-4729766 ATGCATTCCCAGAGGCATGAGGG - Intergenic
1169755591 20:9039933-9039955 ATGGAGTCCCAGAGGTATGGGGG - Intergenic
1169927713 20:10800305-10800327 CCTGAGACCCAGAGGCAGGGTGG - Intergenic
1170787513 20:19480417-19480439 ATATAGTCCCAAAGGCAGGATGG - Intronic
1171442446 20:25176279-25176301 ATGTGGAGCCTGAGGCAGGAGGG - Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172128298 20:32638592-32638614 ACAGAGACCCAGAGCCAGGCAGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172183005 20:33015005-33015027 ACGGAGGCCCAGAGTCAGGAAGG + Intronic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172613625 20:36268925-36268947 ATGGAGGCCTGGAGGAAGGAAGG + Intronic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1173837406 20:46134926-46134948 AGGGAGCCCCAGGGACAGGAAGG - Intergenic
1174561323 20:51432615-51432637 ATGGTGGCCACGAGGCAGGAGGG + Exonic
1175089308 20:56488875-56488897 AGGGAGGCCGAGAGGCAGGGAGG - Intronic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1176373587 21:6076659-6076681 TTGGAAACCCACAGGCAGTAGGG + Intergenic
1176621994 21:9067032-9067054 ATGCAGACCCAGACCCTGGAGGG - Intergenic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1176776874 21:13144507-13144529 ATGAAGACCCAGACACACGATGG + Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1178686470 21:34715183-34715205 GTGGAGACCCAGAGCCATAAAGG - Intronic
1178803542 21:35819063-35819085 AAAGATACCCAGAGGCAAGATGG + Intronic
1179143526 21:38748250-38748272 AACGAGACTGAGAGGCAGGAAGG - Intergenic
1179451573 21:41472066-41472088 CAAGACACCCAGAGGCAGGATGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179749890 21:43461584-43461606 TTGGAAACCCACAGGCAGTAGGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180261792 21:46675242-46675264 TTGGAGGCTCTGAGGCAGGAGGG - Intergenic
1180285647 22:10742179-10742201 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1180914386 22:19475002-19475024 ATGGACACCAAGAGTCAGCATGG - Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181495090 22:23283212-23283234 ATGCAGACCAAGATGCAGAAAGG + Intronic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1181998576 22:26902589-26902611 AAGGAGAGCGAGAGGAAGGAAGG - Intergenic
1182317418 22:29457300-29457322 ATGAGGACCCTGAGGCAGGTGGG - Intergenic
1182334597 22:29575346-29575368 ACTGAGGCCCACAGGCAGGAAGG - Intronic
1182924453 22:34109248-34109270 ATGGAGACAGACAGGAAGGAAGG - Intergenic
1182935515 22:34218305-34218327 ATGAGGAGTCAGAGGCAGGAGGG - Intergenic
1182994139 22:34797431-34797453 AGGAAGGCCCAGAGGCAGGAAGG + Intergenic
1183013017 22:34962884-34962906 GTGGAGGCCCAGAGACGGGAGGG - Intergenic
1183074639 22:35419232-35419254 ACTGAGACCCAGAGGGAGGGAGG - Intronic
1183089747 22:35513764-35513786 AGGGAGAGCCAGAGGGAGAAAGG + Intergenic
1183322409 22:37173063-37173085 AGAAAGACCCAGAGGCCGGAAGG - Intronic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183538884 22:38418277-38418299 AAGAAAACCCAGAGGCTGGAGGG - Intergenic
1183548363 22:38467482-38467504 ATTGAGACCAAGAGAGAGGAAGG + Intergenic
1183758136 22:39790004-39790026 GCAGAGACCCACAGGCAGGAGGG + Intronic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1184090600 22:42291096-42291118 ATGGAGTCCCAGAGACGGGAAGG - Intronic
1184347340 22:43921933-43921955 ATGGAGGCCCAGAGCAAGGCAGG - Intergenic
1184805637 22:46793300-46793322 ATGAGGACTCAGTGGCAGGAGGG - Intronic
1185236561 22:49716828-49716850 ACGAAGACCCAGGGTCAGGAAGG + Intergenic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949875405 3:8623351-8623373 AGTAAGACGCAGAGGCAGGAAGG - Intronic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950618071 3:14178395-14178417 GAGGAGGCCCAGAGGCAGGGCGG - Exonic
950759317 3:15206445-15206467 AAGGAGGCCCTGACGCAGGACGG - Exonic
950882707 3:16336064-16336086 GTGGAGATCTAGAGGCAGGGTGG + Intronic
951429415 3:22588810-22588832 ATGGAAACCCAGGGTCAGCATGG + Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
952961820 3:38596856-38596878 ACTGAGGCCCAGAGACAGGAGGG - Intronic
953275008 3:41486468-41486490 ACGGAGACTCAAAGGCAGGCAGG + Intronic
953442070 3:42926919-42926941 AGGAAGGCCCTGAGGCAGGAGGG + Intronic
953733290 3:45468489-45468511 TTGTAGACCCAGGGGCAGGGAGG + Intronic
954375868 3:50193924-50193946 ATGGGGTCCCCGGGGCAGGACGG - Intronic
954424701 3:50437263-50437285 CTGGAGACCCAGAGGCCTGCAGG - Intronic
954581910 3:51707517-51707539 ACGGAAGCTCAGAGGCAGGAAGG - Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955396985 3:58564556-58564578 ATGAAGCCCCAGAGGTAGAAGGG - Intronic
955420748 3:58734685-58734707 ATGGAGGCCAAGAGACAGGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955929943 3:64046474-64046496 AAGGAAACTGAGAGGCAGGAGGG - Intergenic
956726191 3:72158438-72158460 ATGGAGAGAGAGAGACAGGAAGG + Intergenic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958847548 3:99283073-99283095 ATAGAGAACCAGAGGCGGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960079813 3:113529550-113529572 GTAGAGACTCAAAGGCAGGAAGG + Intergenic
961147117 3:124603518-124603540 AGGGAGAGCCAGGGACAGGAAGG - Intronic
961542277 3:127608252-127608274 ATGGAGAGCCAAAGACAGCAAGG - Intronic
961798298 3:129425467-129425489 CTGAAAACCCAGAGCCAGGAAGG - Intronic
961830772 3:129621999-129622021 GCAAAGACCCAGAGGCAGGAAGG + Intergenic
962347395 3:134628205-134628227 ATGGAAACAAAGATGCAGGAAGG + Intronic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
965678965 3:171230843-171230865 ATGGAGCCACAGGGGAAGGAAGG - Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968292861 3:197552470-197552492 ATGGAGACCCAGAACATGGAGGG - Intronic
968615426 4:1575556-1575578 AGGAAGACAGAGAGGCAGGACGG + Intergenic
969047387 4:4346237-4346259 AGACAGACCCAGAGGAAGGAAGG - Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969173291 4:5380849-5380871 ATTGAGACTCAGAGGAGGGAAGG + Intronic
969187326 4:5486186-5486208 GTGGAGTCTCAGAGGCAGGCTGG + Intronic
969586652 4:8097800-8097822 ATGGAGACCCAGAGGAGTGGGGG - Intronic
970099098 4:12500532-12500554 TTGGAGACCTAAAGGCAGGGAGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972931104 4:44072251-44072273 ATGGGCACCCAAAGTCAGGAGGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974572573 4:63672741-63672763 AAAGAGACCCAGAGGCAAAATGG - Intergenic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
974877441 4:67716325-67716347 CTGGAAACGCAGAGGCATGATGG + Intergenic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978132286 4:105213691-105213713 ATGGAGACTCATAGGAAGGTGGG - Intronic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
980990283 4:139733649-139733671 CTGAAGACCTACAGGCAGGAAGG + Intronic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
982172617 4:152676377-152676399 TTGGAAACCCAGAGGTAGTATGG + Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
982759321 4:159262043-159262065 ATGGGGAACCAGACACAGGATGG - Intronic
984707421 4:182857795-182857817 ATAGGATCCCAGAGGCAGGAGGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985246718 4:187986457-187986479 AGGAAGACACAGAGACAGGAAGG + Intergenic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
986124201 5:4870071-4870093 ATGGAGACCCCAAGGCACAAAGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987038623 5:14041265-14041287 CTGGGGACCATGAGGCAGGAAGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988712760 5:33794590-33794612 ATGGAGACCGAGGTGCAGGTAGG + Intronic
990205981 5:53430176-53430198 ATGAGGGGCCAGAGGCAGGAGGG - Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990458360 5:56010616-56010638 ATGGAGACACAGAGGCTTGCGGG + Intergenic
990978145 5:61576983-61577005 ATGGAGACCCTGAGGCGGGGGGG + Intergenic
990978288 5:61578313-61578335 ATGGAGACTCTGAGGCGGGGAGG - Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991451414 5:66754858-66754880 ATAGAGACCCAGAGGACAGAGGG + Intronic
991546579 5:67788837-67788859 ATGGGGACTCAGAGTCAGGTTGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
994560754 5:101367854-101367876 ATTGAGAGCCAGAGGCAGTATGG - Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995743851 5:115383151-115383173 ATGGCAGGCCAGAGGCAGGAAGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997258857 5:132449988-132450010 AGGGAGACCCGGAGGGAGGTAGG - Intronic
997299663 5:132793357-132793379 ATGGAGACCCGGCAGCAGAAGGG + Intronic
997839326 5:137224760-137224782 AGGGAGACCCGCAGGCAGCATGG + Intronic
998263847 5:140652111-140652133 ATGAAGACCCAGCTGCACGAAGG + Exonic
998496470 5:142594664-142594686 AGGGAGGCCCAGCCGCAGGAAGG - Exonic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999127361 5:149255673-149255695 GTTGAGACCCTGATGCAGGAGGG + Intronic
999334700 5:150705514-150705536 ATGAAGGGCCAGAGACAGGAAGG + Intergenic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
1000163687 5:158626444-158626466 ATGAAGTGCCTGAGGCAGGAGGG + Intergenic
1000516443 5:162241228-162241250 ATGGGGAGCCAGAAGCCGGATGG + Intergenic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1000971582 5:167720784-167720806 GTGGAAGCCCAGAGGAAGGAAGG + Intronic
1001482317 5:172096688-172096710 TTGGAGACCCAGAGACAGCCTGG + Intronic
1001823752 5:174729522-174729544 ATAGAGTCCCACAGGCGGGATGG - Exonic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1004428373 6:15522147-15522169 AAGGGGACCCAGTGGCAGGTGGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006374416 6:33663931-33663953 AGAGAGTCCCAGAGACAGGAGGG - Intronic
1006944897 6:37778585-37778607 AGGGAGACCCAGAGGGTAGAAGG - Intergenic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007212975 6:40211744-40211766 TTGGAGACCCAGAGTCAGTGAGG - Intergenic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1007497373 6:42269340-42269362 ATGGATACCTCGAGGCAGGGAGG - Exonic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1011445248 6:87432457-87432479 ATGGAGAGGGGGAGGCAGGAGGG - Intronic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1011598711 6:89040519-89040541 ATGGTGACACAGAGGTAAGAAGG - Intergenic
1012732729 6:102902349-102902371 ATGGAAACCCAGGAGCAGAAAGG + Intergenic
1012802375 6:103847238-103847260 AGGGAGAGACAGAGGAAGGAGGG + Intergenic
1013290934 6:108718110-108718132 ATGTATTCCCAGAGGCAGTAAGG - Intergenic
1013350523 6:109301757-109301779 ATGGAGACCAAGCAGCAGCATGG + Intergenic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015431098 6:133131157-133131179 TTGCACACCCAGTGGCAGGAAGG - Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016852505 6:148635531-148635553 GTGCTGACCCAGAGGCAGGAAGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017744811 6:157436832-157436854 AAGGAGGCCCAGATGCTGGAGGG + Intronic
1018131368 6:160735037-160735059 AGGGACACCAAGAGGGAGGAAGG + Intronic
1018846533 6:167560712-167560734 ATGGAGACCCTGTGGCACTAAGG + Intergenic
1019190940 6:170250261-170250283 GTCCAGGCCCAGAGGCAGGAGGG - Intergenic
1019429494 7:992189-992211 CTGGAGACCTAGAGGCGGGGGGG - Intergenic
1019552507 7:1610208-1610230 AGGGAGACCCAGTGCCAGGCCGG - Intergenic
1019607842 7:1918962-1918984 GGGGTGACCCAGAGACAGGACGG - Intronic
1019705046 7:2493588-2493610 AGGGAGAGCTAGAGACAGGAGGG - Intergenic
1020061000 7:5152201-5152223 GTGGAGACCTGGAAGCAGGATGG - Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021345271 7:19519714-19519736 ATTGAGACACAGAGGAAGAAAGG + Intergenic
1021437308 7:20634025-20634047 TTGGAGACTCAGAGGCTGAAAGG - Intronic
1022498945 7:30870800-30870822 GAGGAGACCCAGGGGTAGGAAGG - Intronic
1022589803 7:31650884-31650906 ATTGTGTCCCAGAGGCTGGAAGG - Intronic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023869857 7:44257339-44257361 TTGGAGGCCCTGAGGCAGGCTGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024805866 7:53138962-53138984 ATGAAGACCCAGACACACGATGG - Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1025227465 7:57177795-57177817 TTAGTGACGCAGAGGCAGGAGGG + Intergenic
1025885784 7:65590020-65590042 ATGAAGACCCAGACACACGATGG - Intergenic
1026038352 7:66845837-66845859 GAGGAGACGCAGGGGCAGGAAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1026904071 7:74052730-74052752 AGGGAGAGAGAGAGGCAGGAAGG + Intronic
1027213054 7:76165752-76165774 GAGGAGACGCAGGGGCAGGAAGG + Intergenic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028109462 7:86921390-86921412 ACACAGACCCAGAGGGAGGACGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028974265 7:96894027-96894049 TGGGAGACCTAGAGGCAGGATGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029737302 7:102471989-102472011 GTAGTGACCCAGAGGCACGAGGG - Intronic
1030412418 7:109198134-109198156 ATGCAGACACAGAGGCCGGAGGG + Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034627055 7:152501780-152501802 ATGGGGACCCAGAGAAGGGAGGG - Intergenic
1034674498 7:152882838-152882860 ATGGGCACACAGAGGCAAGACGG - Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035022852 7:155809282-155809304 TTAGAGACCCAGAGACAGGGAGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035579849 8:732475-732497 AAGGAGACCCAGACCCAGGCAGG + Intronic
1037246800 8:16844719-16844741 TTAGAGCCCCAGAGGCAGAAGGG + Intergenic
1037734252 8:21554312-21554334 ATGGAGCCCCCGAGGCAGGCAGG - Intergenic
1038050735 8:23808212-23808234 ATGGAGGGCCAGGGGCAGGTAGG + Intergenic
1038156723 8:24998516-24998538 AGGTAGGCCGAGAGGCAGGAAGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038423201 8:27447022-27447044 ATAGAGAGTCAAAGGCAGGAGGG - Intronic
1038448423 8:27620789-27620811 AGGGAGAGCCAGAGGGAGGGAGG - Intergenic
1038729421 8:30113794-30113816 ATGGAGACCCCCTGGCTGGACGG - Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039307563 8:36279186-36279208 AGGAACACCCAGAGGCATGAGGG + Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039559376 8:38500354-38500376 TTGGAGACCCAGAAGCAGAGAGG - Intergenic
1039849099 8:41346873-41346895 AGGGGGACCCAGAGGAAGAAAGG + Intergenic
1040006902 8:42628529-42628551 TGGGAGACCCACAGGCAGGGTGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040533754 8:48288044-48288066 ATGAAGACCTAGAGTCAGAAGGG + Intergenic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041148252 8:54902910-54902932 ATGTAAAGCCAGAGGCTGGATGG + Intergenic
1041515999 8:58699669-58699691 AGGAAGAGCCTGAGGCAGGAAGG + Intergenic
1041787753 8:61654485-61654507 ATGGACAGCCTGCGGCAGGAAGG + Intronic
1041884583 8:62793604-62793626 ATGGAGACGTAGTGGTAGGAGGG + Intronic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1044027008 8:87184709-87184731 ATGTAGACCCGGAGGCTGAAAGG - Intronic
1044429819 8:92095655-92095677 AAGGAGAGACACAGGCAGGAGGG + Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045391393 8:101718536-101718558 ATGCAGACGCTGAGGCAGGGAGG - Intronic
1045886890 8:107108702-107108724 AGGGAGACCCAGCGGAAGGTGGG - Intergenic
1046998219 8:120547793-120547815 ATGAAGAGGCAGAGGCAGAATGG - Intronic
1048673500 8:136750034-136750056 ATGGAAACCAAAAGGCAGCATGG - Intergenic
1048975931 8:139673051-139673073 AAGGAGAACGAGAGGCAAGAAGG + Intronic
1049056040 8:140238405-140238427 AAGGAGACCCAGCACCAGGAAGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050462998 9:5893218-5893240 ATGAAAACCCAGAGGCTGCAGGG + Intronic
1050604652 9:7288127-7288149 ATGAAGCCCCATAAGCAGGATGG - Intergenic
1050823704 9:9915843-9915865 ATGGACATCCAGATCCAGGAAGG + Intronic
1051400778 9:16679726-16679748 ATGGAGAGGAAAAGGCAGGAAGG + Intronic
1051505412 9:17821888-17821910 ATGGATACCCAGCAGCAGGTGGG + Intergenic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1053296463 9:36917822-36917844 AATGTGACCCAGAGACAGGAAGG - Intronic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053681517 9:40488796-40488818 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054282196 9:63136138-63136160 TTGGAGCCTCGGAGGCAGGAGGG + Intergenic
1054294608 9:63324313-63324335 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054392630 9:64628800-64628822 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054427278 9:65134009-65134031 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054503098 9:65887531-65887553 TTGGAGCCTCGGAGGCAGGAGGG + Intronic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054813491 9:69453345-69453367 ATGGAGGCCCAGAGACACAAAGG + Intronic
1055040373 9:71864540-71864562 ATGGAAGCCTAGAGGAAGGAAGG - Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057865191 9:98674792-98674814 AGGGAGACCCTGAGACTGGAGGG + Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059377732 9:113898983-113899005 CTGGAGACTCTGAGGCAGGCTGG - Intronic
1059694862 9:116721435-116721457 ATGGAGCCCCAGTGGGAAGAAGG + Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1060040929 9:120300309-120300331 ATGGACAACCTGAGGCAGAATGG + Intergenic
1060298109 9:122356668-122356690 ACTGAGACCCAGAGACTGGAGGG - Intergenic
1060907908 9:127324431-127324453 ATGGAGGCACGGAGGCTGGAGGG - Intronic
1061334620 9:129923963-129923985 AGGGTGAGGCAGAGGCAGGAGGG + Exonic
1061373693 9:130212051-130212073 ATGGACGCCCTGAGCCAGGAGGG + Intronic
1061407919 9:130402946-130402968 GTGGAGAGCCAGAGGCAGGTGGG + Intronic
1061626131 9:131841779-131841801 GTGAAAAGCCAGAGGCAGGAGGG + Intergenic
1061779910 9:132989335-132989357 TTGGAGACCCAGACCCAGGGAGG - Intronic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1203731999 Un_GL000216v2:99245-99267 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1203564925 Un_KI270744v1:82030-82052 ATGCAGACCCAGACCCTGGAGGG + Intergenic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185920709 X:4088870-4088892 ATTCAGAACCAGAGGCAGCAAGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186320031 X:8414171-8414193 ATGCAGTCCCAGGGCCAGGATGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1187929748 X:24283227-24283249 AGGGAGACCTAGAGGGAAGAAGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188208509 X:27389947-27389969 GTGGAGACTCAAAGGCAGGCAGG - Intergenic
1188604912 X:32016278-32016300 AGGGTGACCCGGAAGCAGGAGGG - Intronic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1190300590 X:49054774-49054796 ATGGAGGTCAAGAGGCAGGATGG - Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190732733 X:53235708-53235730 ATGGAGACCCAGAGGAGGAGGGG - Intronic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1191146047 X:57166185-57166207 ATGGAAAGCCAGAGGGGGGATGG - Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192056507 X:67779240-67779262 ATTGTGTCCCAGAGGCAGGCTGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192561418 X:72130479-72130501 ATGAAGACCAAGAGGCACGCAGG - Exonic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195215925 X:102702088-102702110 AGGGAAACCCAAAGGCAGCAGGG + Intergenic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1195694748 X:107658712-107658734 AGTGAGACCCTGAGGAAGGAAGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196793139 X:119482154-119482176 ACGGAGGCCCAGAGGAAGGGAGG + Intergenic
1196934602 X:120716998-120717020 ATGGAAATCAAGAGGCATGAGGG + Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197160781 X:123319706-123319728 ATAAAGACACAGAGGCAAGAAGG - Intronic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198231439 X:134693231-134693253 CTGGAGAGCTGGAGGCAGGAAGG - Intronic
1198421408 X:136473216-136473238 AGGGAGAGAGAGAGGCAGGAAGG + Intergenic
1198962305 X:142195541-142195563 ATGGGATCCCAGAGGCATGAGGG + Intergenic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1201158514 Y:11152489-11152511 ATGCAGACCCAGACCCTGGAGGG - Intergenic
1201187178 Y:11415838-11415860 AAGAAGACCCTGAGGAAGGAAGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201763943 Y:17562981-17563003 ATGGGGACGCTGAGGCAGCACGG - Intergenic
1201837610 Y:18343009-18343031 ATGGGGACGCTGAGGCAGCACGG + Intergenic