ID: 1165476019

View in Genome Browser
Species Human (GRCh38)
Location 19:36031567-36031589
Sequence CTGGGTAAAGGATCTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165476019_1165476023 -7 Left 1165476019 19:36031567-36031589 CCTACCTCAGATCCTTTACCCAG 0: 1
1: 0
2: 1
3: 31
4: 344
Right 1165476023 19:36031583-36031605 TACCCAGCGGTTACCTCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 63
1165476019_1165476024 -6 Left 1165476019 19:36031567-36031589 CCTACCTCAGATCCTTTACCCAG 0: 1
1: 0
2: 1
3: 31
4: 344
Right 1165476024 19:36031584-36031606 ACCCAGCGGTTACCTCTCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165476019 Original CRISPR CTGGGTAAAGGATCTGAGGT AGG (reversed) Intronic
900703509 1:4062141-4062163 CTGGGTCAAGGAGCTCAGGATGG - Intergenic
901203364 1:7479374-7479396 CTGGAGTAAGGATCTGGGGTGGG + Intronic
902050131 1:13557320-13557342 CTGGGCAAATCACCTGAGGTCGG + Intergenic
903829210 1:26164658-26164680 CTGGGAAAGGGGTCTGGGGTGGG + Intergenic
904828348 1:33290016-33290038 TTGGATAAAGGATTGGAGGTGGG + Intronic
905510056 1:38512098-38512120 CTACATAAAGGATTTGAGGTAGG - Intergenic
905881485 1:41467129-41467151 CTGGGTACAGGACCTGGGTTGGG - Intergenic
905973372 1:42157317-42157339 CTGAATAAAGGCACTGAGGTTGG - Intergenic
906721082 1:48005278-48005300 CTGGGAAAAGGCCCAGAGGTGGG + Intergenic
907142119 1:52196781-52196803 ATGGATAAAGAATCAGAGGTGGG + Intronic
907266841 1:53267038-53267060 CTGAGCAAAGGCTCTGAGGCAGG - Intronic
907750917 1:57262437-57262459 CTGGGGGAAGCATCTGGGGTAGG - Intronic
909766702 1:79365384-79365406 CTGGGTAATGGCTCAGAGATTGG - Intergenic
911382886 1:97138083-97138105 CTGGATAAAGGATGTTAGCTAGG + Intronic
912963040 1:114213053-114213075 CTGGGGAAAGTTTCTGAGGAAGG + Intergenic
914390448 1:147217010-147217032 GTGGGTAGATCATCTGAGGTCGG + Intronic
915221827 1:154380690-154380712 CTTGGTACATGATGTGAGGTAGG - Intergenic
918260361 1:182789953-182789975 CTGGGAAACGGATCTGGGGAAGG + Intronic
918298464 1:183180490-183180512 CTGGGTAAATTCTCTGAGGCTGG - Intergenic
919135271 1:193500115-193500137 CTGGGTGAAGGAGCAGAGTTTGG - Intergenic
920763937 1:208812806-208812828 CTGGACACAGGCTCTGAGGTGGG + Intergenic
920852238 1:209635931-209635953 CTGGACAAAGGCTCTGAGGAGGG - Intronic
922491674 1:226022082-226022104 ATGGGTAAAGGTACTGAGGTAGG + Intergenic
923409373 1:233691808-233691830 CTGGGTAAGGGATCTCAGCACGG - Intergenic
924872556 1:248064593-248064615 ATGGGTAAAGGGTCTGAACTGGG - Intronic
1062824004 10:555686-555708 CTGATTAACGCATCTGAGGTGGG - Intronic
1063639683 10:7817686-7817708 CTGGGAGAAGGCTCTGGGGTAGG + Intergenic
1065231999 10:23607841-23607863 TCCGGTAAAGGATCTTAGGTTGG - Intergenic
1065285247 10:24181366-24181388 CTGTAGAAAGGCTCTGAGGTGGG + Intronic
1065299003 10:24303618-24303640 ATGGGGAGGGGATCTGAGGTGGG + Intronic
1066200434 10:33138790-33138812 ATGGGCAAATCATCTGAGGTTGG + Intergenic
1067852189 10:49761274-49761296 TTGGGTTGAGGTTCTGAGGTTGG - Intronic
1070112784 10:73500700-73500722 CTGGGGACAGGAACTGTGGTTGG + Exonic
1071070966 10:81693462-81693484 CGGGGTAAAGGATGAGAGATGGG + Intergenic
1071346809 10:84701236-84701258 ATGAGTACAGGATGTGAGGTAGG + Intergenic
1071600836 10:86958081-86958103 CCGGTTGGAGGATCTGAGGTGGG - Intronic
1071809900 10:89168075-89168097 CTGGGCAAAGGCTGTGAGTTGGG - Intergenic
1072134868 10:92535805-92535827 GTGGGTAGATCATCTGAGGTCGG + Intronic
1072147953 10:92659411-92659433 GTGGGTGAATCATCTGAGGTCGG - Intergenic
1072411763 10:95209235-95209257 AGAGGTAAAGGACCTGAGGTGGG + Intronic
1072638850 10:97196066-97196088 CTGGGTCAGGGAGCTGAGGTAGG + Intronic
1075220654 10:120581639-120581661 CTGTGGAAAGGCTCTGAGGTGGG - Intronic
1076322622 10:129594748-129594770 CTGGGGACAGTATCTGTGGTAGG - Intronic
1077483139 11:2825934-2825956 ATGGGGACAGGATCTGAGGAAGG - Intronic
1078306671 11:10195045-10195067 CTGGTTAAAGTTTCTGAGGCTGG + Intronic
1078911608 11:15737883-15737905 CTGGGTACAGAATCTGTGGATGG + Intergenic
1078922689 11:15845253-15845275 CTGGGTCCAGGCTCTGAGCTGGG + Intergenic
1080166755 11:29246378-29246400 CTGGGTACAGAATCCTAGGTTGG - Intergenic
1080588546 11:33701505-33701527 ATGGGTGAAGTATTTGAGGTAGG - Intronic
1082176696 11:49068456-49068478 CTGGGGACAGGAGATGAGGTGGG - Intergenic
1083548257 11:63564879-63564901 CTGCTGAAAGGATCTCAGGTGGG + Intergenic
1083661638 11:64254194-64254216 CTGGGAAGAGGCTTTGAGGTAGG + Intronic
1084315176 11:68341677-68341699 CTGGGCAAAGGTCCTGGGGTGGG - Intronic
1084587460 11:70070949-70070971 TTGGGTAAGAGATCTGAGGCAGG - Intergenic
1084655407 11:70512925-70512947 CTGGGTATAAAATTTGAGGTTGG + Intronic
1085469732 11:76749871-76749893 CATGGTAAAGGCTCTAAGGTGGG - Intergenic
1086689009 11:89767421-89767443 CTGGGGACAGGAGATGAGGTGGG + Intergenic
1086716847 11:90072539-90072561 CTGGGGACAGGAGATGAGGTGGG - Intergenic
1089221157 11:116873151-116873173 CTGGGAGAAGGCTCTGAGTTAGG + Intronic
1089931918 11:122321425-122321447 CTGGAGAAAAGACCTGAGGTGGG + Intergenic
1090109205 11:123886710-123886732 CTGGGAAAAGGCTCTGAGGCAGG + Intergenic
1091764302 12:3108323-3108345 CTTGGTATAGGATCTCAGCTAGG + Intronic
1092236790 12:6815437-6815459 CAGGGGACAGGATCTGGGGTAGG - Intronic
1092269641 12:7013212-7013234 GTGTGCAAAGGCTCTGAGGTAGG + Intronic
1092438695 12:8476847-8476869 CTGGGTAAAGACTGGGAGGTTGG - Intronic
1092551733 12:9509553-9509575 CTGGGAAAACTAGCTGAGGTTGG + Intergenic
1093823459 12:23651669-23651691 CTGGGGAAAGAATCAGAGGAGGG + Intronic
1094302222 12:28977789-28977811 CTGGGTATAGAATTTTAGGTTGG - Intergenic
1094399822 12:30050401-30050423 CTGGATAATGGATCAGAAGTTGG - Intergenic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1097795498 12:63857305-63857327 GTGGGTGAATCATCTGAGGTCGG - Intronic
1098988395 12:77037048-77037070 CTGGGTAAAGAATTCTAGGTTGG - Intronic
1101493353 12:105230693-105230715 CTGGGTAGAGCATGTGTGGTGGG - Intronic
1101915576 12:108893146-108893168 CTGGGGCAAGGGTCTGAGGCAGG - Intronic
1102114562 12:110393021-110393043 GTGGGTGAATCATCTGAGGTTGG - Intronic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102207297 12:111099240-111099262 CTGGCCAAAGGCTCGGAGGTGGG + Intronic
1103697767 12:122830964-122830986 ATGTGCAAAGGCTCTGAGGTGGG + Intergenic
1105205703 13:18221725-18221747 CTGAGTGAAGGACCTGAGATGGG - Intergenic
1105211216 13:18258240-18258262 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1106323580 13:28665852-28665874 TAGGGTAAAGTATATGAGGTTGG + Intronic
1107847898 13:44536626-44536648 CTGGGTAAAGGAACTGTTTTTGG + Intronic
1110139257 13:72107187-72107209 CTGGGGAAAGGATGGGAGGTGGG - Intergenic
1110176379 13:72561196-72561218 CTGTGCAAAGGATTTGGGGTGGG + Intergenic
1112437169 13:99398882-99398904 CTGAGTAGAAGATCTGAGGCTGG - Intergenic
1113660938 13:112105840-112105862 CTGGGGGAGGGACCTGAGGTGGG - Intergenic
1114004682 14:18299535-18299557 ATGGGTAAATCATATGAGGTCGG - Intergenic
1117490292 14:56240358-56240380 CTGGGTAAATGATTGGATGTGGG + Intronic
1118438497 14:65792241-65792263 CTGGGCAAAGCCCCTGAGGTGGG + Intergenic
1118499624 14:66346989-66347011 TTAGATAAAGGAGCTGAGGTGGG + Intergenic
1118968088 14:70607004-70607026 CTGGGTTAAGGGTGTGAGGGAGG - Intergenic
1119134358 14:72203436-72203458 GTGGGTAAAGGATCTGGGTTTGG + Intronic
1119557586 14:75565549-75565571 ATGTGCAAAGGCTCTGAGGTAGG - Intergenic
1119643841 14:76334626-76334648 CTCCCTAAAGGATCTGATGTGGG + Intronic
1119935112 14:78585268-78585290 CAGTGCAAAGGACCTGAGGTGGG + Intronic
1120387994 14:83869368-83869390 GTGGGTAAATCACCTGAGGTTGG + Intergenic
1121753021 14:96374701-96374723 CTGGGTAGAGAATCCTAGGTTGG - Intronic
1122251935 14:100445956-100445978 TGAGGTAAAGGATCTGAGGCTGG + Intronic
1122433124 14:101669835-101669857 CTGGGTAAAGTATTTTTGGTTGG - Intergenic
1122508239 14:102245842-102245864 CTGGTTGGAGGATCGGAGGTGGG - Intronic
1123389147 15:19851781-19851803 ATGGGTAAGTCATCTGAGGTCGG - Intergenic
1124549898 15:30670239-30670261 CTGGGGCAAGGAACTGAGGTTGG + Intronic
1126106158 15:45148262-45148284 CTCGATGAAGGATCTGGGGTTGG - Exonic
1126570980 15:50150339-50150361 CTGAGAAATGGATCTGGGGTAGG - Intronic
1126717661 15:51537729-51537751 CTGGATAGAGAATCTGAGGCAGG - Exonic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1127969615 15:63948037-63948059 GTGGGCAAAGCACCTGAGGTCGG + Intronic
1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG + Intergenic
1129771135 15:78204297-78204319 CGGGGTAAGGGACCTGAGATGGG + Intronic
1130763139 15:86841615-86841637 GTGGGTGAATCATCTGAGGTCGG + Intronic
1131676064 15:94671967-94671989 ATGGGTATGGGATCTGGGGTGGG + Intergenic
1132587869 16:714157-714179 CTGGGTCAAGGGCCTGAGGAAGG - Intronic
1134211896 16:12284525-12284547 CTGGGTACATGACCTGAGCTAGG + Intronic
1134296594 16:12951653-12951675 CTGGTAAAAGGATCTGGGGGAGG + Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1137825723 16:51493208-51493230 CTGGGTGAAGGGTTTGGGGTTGG - Intergenic
1138331633 16:56220151-56220173 GCAGGTAAAGAATCTGAGGTTGG + Intronic
1138876094 16:60951888-60951910 TTGAGTAAAGAATATGAGGTAGG + Intergenic
1138982816 16:62291387-62291409 CTGGGTAAAGAATTTCATGTAGG - Intergenic
1139343403 16:66286658-66286680 CTGAGTAAAGGTGCTGAGGTGGG + Intergenic
1140613503 16:76631568-76631590 CTGGGTAAAGCATTTTTGGTTGG + Intronic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1142309731 16:89305497-89305519 CTGGGTGAAGGTTCTGCGGTCGG - Intronic
1142367270 16:89657105-89657127 CGGGGTAAAGGATCTCGGGTTGG + Intronic
1142618589 17:1151393-1151415 CTGGGTGCAGGAACTGAGCTTGG - Intronic
1143332768 17:6149571-6149593 CTGTGAAAAGGCCCTGAGGTTGG - Intergenic
1143590549 17:7884170-7884192 CTGGGTAAAGGCTTGGAGATGGG + Intronic
1144019779 17:11229961-11229983 CAGGGTACAGGATATCAGGTTGG + Intergenic
1144560629 17:16317934-16317956 CTGGGGCAGGGATCTGAGTTGGG - Intronic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145262681 17:21364221-21364243 CTGGGGAAAGGATGAGAGGGTGG + Intergenic
1146897765 17:36557708-36557730 TAGTGTAAAGGTTCTGAGGTTGG + Intronic
1147724979 17:42561517-42561539 GTGGGCAGAGCATCTGAGGTCGG - Intronic
1148340581 17:46871205-46871227 CAGGGTAAAAGATCAAAGGTGGG - Intronic
1148874750 17:50680331-50680353 CTGGGCAAAGGAGTGGAGGTGGG + Intronic
1149051513 17:52310618-52310640 CTGGGTAACAGGTCTGAGGTTGG - Intergenic
1150634853 17:66905706-66905728 CATGGGAAAGGCTCTGAGGTGGG + Intergenic
1152329911 17:79666656-79666678 ATGGGTAAATCACCTGAGGTTGG + Intergenic
1153030173 18:706469-706491 CTGGGAAAAGGCACTGAAGTTGG - Exonic
1153166020 18:2263023-2263045 CTGGGTACAGAGACTGAGGTGGG + Intergenic
1153741599 18:8135469-8135491 CTGGATCAAAGGTCTGAGGTAGG - Intronic
1153788487 18:8556060-8556082 CAGGGTAAAGGATGGGAGATAGG + Intergenic
1155388437 18:25307199-25307221 GTGGGGAAAGGATTTGAGATAGG - Intronic
1155551773 18:26972672-26972694 CTTGATAAAGGATCTGTGTTGGG + Intronic
1155911061 18:31504755-31504777 CTGGGGAAAGTATCTGAGTAGGG - Intronic
1156106989 18:33675302-33675324 CTGGCTAAAGGATATGAGGTGGG - Intronic
1159193935 18:65086767-65086789 CTGGGTAAAGTAACTGGGGAAGG + Intergenic
1160010708 18:75105533-75105555 CTGGGGAAGAGAGCTGAGGTTGG + Intergenic
1160280528 18:77485780-77485802 ATAGGAAAAGGATCTGAGGGAGG - Intergenic
1161658048 19:5527983-5528005 CTGGCTAAGAGGTCTGAGGTAGG + Intergenic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162520680 19:11177826-11177848 GTGGGTAAAGGCTCAGAGGTGGG - Intronic
1162822756 19:13233175-13233197 CTGTGTAAAGGCCCTGAGGCAGG - Intronic
1163166399 19:15500973-15500995 CTGTGTAAAGGACCTGAGGCTGG - Intergenic
1163255746 19:16154770-16154792 TTGTGCAAAGGACCTGAGGTGGG - Intronic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1163730805 19:18948219-18948241 ATGGGCAAAGGCCCTGAGGTGGG + Intergenic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165374488 19:35432141-35432163 CTGGGGAAAGGAGAGGAGGTGGG + Intergenic
1165476019 19:36031567-36031589 CTGGGTAAAGGATCTGAGGTAGG - Intronic
1165807277 19:38588160-38588182 CTGTGCAAAGGATTTGAGGTGGG + Intronic
1166119910 19:40680059-40680081 GTGGGTAAAGAATGTGATGTTGG - Intronic
1167160999 19:47767012-47767034 CTGGGGAAAGCAGCTGAGATGGG - Intergenic
1167366574 19:49057786-49057808 GTGGCTAAAGGATCTGGGGCGGG - Exonic
925493141 2:4418205-4418227 CTGGATAAAGGAAATGTGGTAGG + Intergenic
925706364 2:6687283-6687305 ATGGGTACAGGATGGGAGGTGGG + Intergenic
926221980 2:10942366-10942388 CTGGGTGAGGGATATGAGGGTGG - Intergenic
929005923 2:37392647-37392669 CTGTGCAAAGGTCCTGAGGTAGG - Intergenic
930235419 2:48884560-48884582 CTGGGAGAAGGAGCAGAGGTTGG - Intergenic
930609721 2:53528371-53528393 CTGGGTATAGAATTTTAGGTTGG - Intergenic
933476530 2:82798869-82798891 GTGGGTGGAGCATCTGAGGTCGG - Intergenic
937718702 2:125064834-125064856 CTAGGTAAAGGGTCTGAAGAGGG - Intergenic
937840363 2:126518873-126518895 ATGGGTACAGGATGGGAGGTGGG - Intergenic
938531841 2:132195560-132195582 ATGGGTAAATCATCTGAGGTCGG + Intronic
940044543 2:149395070-149395092 CTTGGAATAGGATATGAGGTGGG + Intronic
940924156 2:159344979-159345001 GTGGGCAGATGATCTGAGGTCGG + Intronic
945362913 2:208913268-208913290 TTGGGGAAAGGATGAGAGGTGGG + Intergenic
945550657 2:211218059-211218081 CAGGGGAAAGGATAGGAGGTGGG + Intergenic
947089950 2:226498424-226498446 CTGGAGAAAGCAACTGAGGTGGG + Intergenic
947644204 2:231726371-231726393 ATGGTTACAGGACCTGAGGTGGG + Intergenic
948495648 2:238346933-238346955 CTGGGTGAAGGTGCAGAGGTGGG + Intronic
1168967895 20:1910439-1910461 CTGGGAAATGGGACTGAGGTAGG - Intronic
1168968517 20:1914742-1914764 CTGGGCAAAGACTCAGAGGTAGG - Intronic
1169919684 20:10721510-10721532 ATGGTTAAAGGAACTGAGATTGG - Intergenic
1170030326 20:11937594-11937616 TTAGGTGAAGGGTCTGAGGTGGG - Intergenic
1170449525 20:16467735-16467757 CAGGGTACAGGATTTTAGGTTGG - Intronic
1170715746 20:18829420-18829442 CTGGCTACAGGATCTGAGGGAGG - Intronic
1171059493 20:21942659-21942681 TGGGGTAAAGTATCAGAGGTAGG - Intergenic
1172395167 20:34598261-34598283 ATGGGTATGGGACCTGAGGTGGG + Intronic
1172446885 20:34997870-34997892 CTGGTTCAAGGGTCTGAGGCTGG - Intronic
1172897140 20:38308213-38308235 CTGTGTATATAATCTGAGGTGGG - Intronic
1173198236 20:40933547-40933569 CTGTGCAAAGGATATGGGGTAGG + Intergenic
1173598037 20:44272399-44272421 CTGGGGAAAGGATGTGAGAAGGG + Intronic
1173861609 20:46287522-46287544 CTGGGTAGAGGCCCTGAGGCTGG + Intronic
1174023394 20:47550214-47550236 GTGGGCAAATGACCTGAGGTTGG + Intronic
1174058317 20:47814997-47815019 CTGGTAGAAGGATCTGAGGTGGG + Intergenic
1174314087 20:49683637-49683659 GTGGGCAAATCATCTGAGGTTGG - Intronic
1174577487 20:51546905-51546927 ATGTGTAAAGGCTCTGAGGCAGG + Intronic
1174703988 20:52637147-52637169 CTGGGCAAAGGTGTTGAGGTGGG + Intergenic
1175949634 20:62576501-62576523 CTGGGAGAAGGAGCAGAGGTGGG - Intergenic
1176414994 21:6468942-6468964 CTGGCTGAAGGCTCTGAGGGAGG - Intergenic
1176764620 21:13003878-13003900 ATGGGTAAATCATCTGAGGTCGG - Intergenic
1177832038 21:26149911-26149933 CAGTGTAAAGGCTGTGAGGTGGG - Intronic
1179690494 21:43077274-43077296 CTGGCTGAAGGCTCTGAGGGAGG - Intergenic
1180204390 21:46248555-46248577 TTGGGTAAGGCATCTGAGGAGGG + Intronic
1180429196 22:15230325-15230347 ATGGGTAAATCATATGAGGTCGG - Intergenic
1180511814 22:16098684-16098706 ATGGGTAAATCATCTGAGGTCGG - Intergenic
1180760265 22:18196991-18197013 CTGAGTGAAGGACCTGAGATGGG + Intergenic
1180765020 22:18341197-18341219 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1180770577 22:18381289-18381311 CTGAGTGAAGGACCTGAGATGGG + Intergenic
1180775404 22:18427705-18427727 CTGAGTGAAGGACCTGAGATGGG - Intergenic
1180808473 22:18738760-18738782 CTGAGTGAAGGACCTGAGATGGG - Intergenic
1180814009 22:18778487-18778509 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1180828520 22:18884247-18884269 CTGAGTGAAGGACCTGAGATGGG + Intergenic
1180961613 22:19764897-19764919 CTGGGCTGAGGATCTGGGGTGGG - Intronic
1181071403 22:20343724-20343746 CTGAGTGAAGGACCTGAGATGGG - Intergenic
1181194475 22:21172674-21172696 CTGAGTGAAGGACCTGAGATGGG - Intergenic
1181200194 22:21212822-21212844 ATGTGCAAAGGACCTGAGGTAGG + Intronic
1181214967 22:21320104-21320126 CTGAGTGAAGGACCTGAGATGGG + Intergenic
1181701543 22:24624137-24624159 ATGTGCAAAGGACCTGAGGTAGG - Intronic
1181834973 22:25597849-25597871 TTGGGTATAGGATCCCAGGTTGG - Intronic
1181907559 22:26211409-26211431 CTGGGCCTAGGACCTGAGGTGGG - Intronic
1182318966 22:29466065-29466087 CTCGGTAAGGTGTCTGAGGTTGG + Intergenic
1183301346 22:37060616-37060638 CTGGGGAAAGCAGCTGAGGATGG - Intronic
1183740435 22:39665858-39665880 CTGGGGAAAGGGGGTGAGGTTGG - Intronic
1203226643 22_KI270731v1_random:82102-82124 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1203232412 22_KI270731v1_random:122461-122483 CTGAGTGAAGGACCTGAGATGGG + Intergenic
1203264108 22_KI270734v1_random:4174-4196 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1203278614 22_KI270734v1_random:110236-110258 CTGAGTGAAGGACCTGAGATGGG + Intergenic
949514151 3:4792222-4792244 TTAGGTTAAGGATGTGAGGTGGG - Intronic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
950685444 3:14614927-14614949 CTGAGTACAGAATTTGAGGTTGG - Intergenic
952362912 3:32648612-32648634 GTGGGTGGATGATCTGAGGTTGG - Intergenic
953174201 3:40534703-40534725 CTGGGTAAAGGAGGAGGGGTGGG - Exonic
953310414 3:41872456-41872478 CTGGGGCAAGGAACTGAGGTTGG - Intronic
953405411 3:42657364-42657386 CCGGGAAAAGGATCTGGGGCAGG + Intronic
954606062 3:51910575-51910597 CTGGGTATAGAATTTTAGGTTGG - Intergenic
954756856 3:52845414-52845436 TTGGGTAAGGGATGGGAGGTGGG - Intronic
954932128 3:54293347-54293369 CTGGGGAAAGGTTGTAAGGTGGG - Intronic
955755460 3:62220937-62220959 GTGGGTAGAGGATCCAAGGTGGG - Intronic
956832718 3:73069303-73069325 CTCAGTTAAGGATTTGAGGTGGG - Intergenic
959498355 3:107076814-107076836 ATGGGGAAAGGATCTGACGGAGG + Intergenic
962877876 3:139549740-139549762 CTGGGTGAAGGAGCTGAAGCAGG - Intergenic
963256098 3:143146314-143146336 CTGGGTAAAGGGGTTGAGTTGGG - Intergenic
963793849 3:149611675-149611697 TGGGGTACAGGATATGAGGTGGG + Intronic
965712376 3:171568408-171568430 CTTGGTAACACATCTGAGGTTGG + Intergenic
968035106 3:195541917-195541939 CTGGATAAAGGATCTTATTTAGG - Intronic
968241192 3:197087859-197087881 CTGGGAAAAGGAACTTTGGTGGG - Intronic
968328604 3:197844104-197844126 CTAGGTAGAGGTTCTGAGGTAGG + Intronic
969136293 4:5031809-5031831 CTGGGTGAGGGATCTGAGGAGGG - Intergenic
970372748 4:15424496-15424518 CTGAGTACAGAATCTGAGGCTGG - Intronic
971029542 4:22621514-22621536 CTTGATAAAGGATCTGTGTTGGG + Intergenic
971328631 4:25664451-25664473 CTTCATAAATGATCTGAGGTCGG - Intronic
971462108 4:26910938-26910960 CTGTTTAAAGCATTTGAGGTCGG + Intronic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
972787366 4:42339555-42339577 CTGGAGAAAGGAGCAGAGGTCGG - Intergenic
974105627 4:57466805-57466827 CTGGGAAAAGGGTAAGAGGTGGG - Intergenic
975788070 4:77915520-77915542 CTGGGTTAAGGAGCTGAGATGGG - Intronic
977022641 4:91775832-91775854 CTGGCTAAAGGAACTAAGTTTGG + Intergenic
977294797 4:95198613-95198635 CTGTGCAAAGGAACTGAAGTGGG + Intronic
979292043 4:118989139-118989161 CTTGGGAAAGCATCTGAGCTTGG + Intronic
980108054 4:128607425-128607447 ATGGGCAAAGGCTCTGTGGTAGG + Intergenic
980326179 4:131349800-131349822 AAGGGTAAATTATCTGAGGTGGG - Intergenic
981696989 4:147568810-147568832 CTGGGGAAATGATCACAGGTTGG + Intergenic
984937594 4:184902723-184902745 CTGGGCCAAAGATCTAAGGTTGG - Intergenic
986298960 5:6463322-6463344 CTGGGGAAAGAATTTGAGTTTGG + Intronic
987005162 5:13703146-13703168 CTGGGTAGAGGGTGTGGGGTGGG - Intronic
987140971 5:14945888-14945910 GTGGGTAAAGCATGGGAGGTGGG - Intergenic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
990796416 5:59546636-59546658 CTAGGTAAAAGATGTGAGATAGG - Intronic
991055132 5:62311917-62311939 ATAGGTGAAGAATCTGAGGTTGG + Intronic
991155133 5:63425349-63425371 CAGGGAAAAGGATGGGAGGTGGG - Intergenic
991425645 5:66489191-66489213 CTGGGTTAAGAATTTTAGGTTGG - Intergenic
992345920 5:75878580-75878602 TTGGGTAAAGGGTATGAGCTGGG - Intergenic
992796840 5:80260964-80260986 GTGGGTAAATCACCTGAGGTTGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994023785 5:95058916-95058938 CTGGACACAGGATCTGAGATGGG - Intronic
996896231 5:128486550-128486572 ATAGGAAAAGGTTCTGAGGTAGG - Intronic
998256002 5:140588873-140588895 CTGAGTAAAGGATGTAAAGTGGG + Intronic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998533265 5:142904642-142904664 CTGGGGAAAGGCTCTGTGATGGG + Intronic
998856351 5:146398675-146398697 ATGGGCAAAGGATTGGAGGTGGG - Intergenic
1001589917 5:172858200-172858222 ATGGGCAAAGGCCCTGAGGTGGG + Intronic
1001864450 5:175091349-175091371 CTGAGTAAGGGAGCTGAGCTGGG - Intergenic
1002169496 5:177367266-177367288 GTGGGTATAGGAACTGAGGTCGG + Intronic
1002554817 5:180028108-180028130 GTAAGTGAAGGATCTGAGGTGGG - Intronic
1002979731 6:2124682-2124704 CTGGAGAAAGGCTATGAGGTGGG - Exonic
1003727636 6:8783575-8783597 CTGGGTAAAGGCTGGGAGGTGGG - Intergenic
1005958694 6:30681870-30681892 CTGGGGAAACGATCTGCGGGTGG + Intronic
1007005230 6:38355958-38355980 CTGGGTACAGAATCTCAAGTTGG + Intronic
1008057759 6:46962886-46962908 CTGGGGAAAGGATGTGGGGCTGG - Intergenic
1008116789 6:47560135-47560157 CAGGGTAAAGGATCTAAGAGAGG - Intronic
1008348019 6:50453473-50453495 CTTGGCAAAGGCCCTGAGGTAGG - Intergenic
1011232818 6:85182089-85182111 CTGGGTATAGAATTTTAGGTTGG - Intergenic
1011326782 6:86157110-86157132 CTAGGTAAAGGAGCTATGGTAGG - Intergenic
1013156787 6:107499784-107499806 CTGGGTAAAGATTTTGAGGGAGG + Intronic
1013481057 6:110553205-110553227 GTGGGTAGATCATCTGAGGTCGG - Intergenic
1014012602 6:116493687-116493709 CTGGGTATAGGAACTGATGATGG - Intergenic
1014988294 6:128040381-128040403 CTGGGCTATGCATCTGAGGTAGG - Intronic
1015835953 6:137420159-137420181 CTGGCTGAGGGATATGAGGTTGG - Intergenic
1016962764 6:149689182-149689204 CTGCATAAAGGTCCTGAGGTGGG + Intronic
1017483270 6:154879478-154879500 ATGTGTTAAGGATATGAGGTTGG - Intronic
1018501856 6:164419703-164419725 CTGAGTAAAAGATCTGTGGGAGG + Intergenic
1019086924 6:169487116-169487138 ATAGATAAAGGAGCTGAGGTGGG - Intronic
1019309364 7:352761-352783 CTGGGTGGAGGAAGTGAGGTGGG - Intergenic
1019651156 7:2159323-2159345 CTGTGCAGAGGACCTGAGGTGGG - Intronic
1019714222 7:2530915-2530937 CTGGGCAAAGGTGCAGAGGTGGG + Intergenic
1019914037 7:4120489-4120511 CTGGGTATAAAATTTGAGGTTGG - Intronic
1019930950 7:4222768-4222790 GTTGGTAAAGGATGTGAGTTTGG + Intronic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1020081574 7:5288880-5288902 GTGGGTAAAGGATGGGAGGTAGG - Intronic
1021234852 7:18130295-18130317 CTGTATAAAGGCCCTGAGGTAGG + Intronic
1021621322 7:22553323-22553345 CTGGGTAGAGGCTCTGCGGTAGG - Intronic
1021785289 7:24145353-24145375 CTTGGCAAAGAATCTGAGTTAGG - Intergenic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1023403347 7:39806689-39806711 GTGGGTAGATCATCTGAGGTGGG + Intergenic
1023784141 7:43689139-43689161 CTGGGTCAAGGAGCTCAGTTAGG - Intronic
1024224532 7:47315446-47315468 CTGGGTAAAGGAAATGAAGGAGG - Intronic
1024836774 7:53529891-53529913 ATGGGTAAAGAATCTCAGCTGGG - Intergenic
1025197333 7:56943283-56943305 GTGGGTAAAGGATGGGAGGCAGG + Intergenic
1025674615 7:63633656-63633678 GTGGGTAAAGGATGGGAGGCAGG - Intergenic
1025712861 7:63927828-63927850 CTGGGGAAAGGGTGTGAGGCAGG - Intergenic
1026808354 7:73442162-73442184 CGTGGTAAGGGAGCTGAGGTGGG - Exonic
1026974940 7:74491698-74491720 CTGGGTAAAGAAAATGTGGTAGG - Intronic
1028863871 7:95685205-95685227 CAAGGTGAAGGATCAGAGGTAGG - Intergenic
1031070471 7:117155900-117155922 CAGTGTAAAGTTTCTGAGGTGGG - Intronic
1031686997 7:124742946-124742968 GGGGGAAAAGGTTCTGAGGTAGG - Intergenic
1031927195 7:127650264-127650286 GTGGGTAAGGAATCTGGGGTGGG - Intergenic
1032390540 7:131552718-131552740 CTTGGGACAGGATCTGAGGCAGG - Intronic
1034256867 7:149729465-149729487 CTGGGGAAAGGATGAGAGATGGG - Intronic
1036107063 8:5852758-5852780 CTGTGCAAATGATCAGAGGTTGG + Intergenic
1036382992 8:8250951-8250973 ATGAGTGAAGGCTCTGAGGTGGG + Intergenic
1037162539 8:15790640-15790662 CTAGGTAGAGGTTGTGAGGTAGG - Intergenic
1037418296 8:18674776-18674798 GTGGGAGAAGCATCTGAGGTGGG + Intronic
1037582976 8:20256663-20256685 CTTGCTAAAGGATCAGATGTAGG + Intronic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1039546447 8:38414342-38414364 CTGGGTAGAGGATTTGTGCTGGG - Intronic
1039561675 8:38517300-38517322 CTGTATAAACGATCTGGGGTGGG - Intronic
1040837977 8:51752608-51752630 CTGACTAAAGGATGTGGGGTGGG + Intronic
1044966101 8:97575425-97575447 TAGGGCAAAGGTTCTGAGGTGGG + Intergenic
1045401841 8:101827073-101827095 CTGGGTCAAAGATATGATGTTGG + Intronic
1047507591 8:125491942-125491964 CTGGGTAATGGTTCTGAGTTTGG + Intergenic
1049389120 8:142359071-142359093 CTGGGTGAAGGCACAGAGGTGGG - Intronic
1051155847 9:14144994-14145016 TTGACTAAAGGATCTGAAGTAGG + Intronic
1052121792 9:24727005-24727027 ATGAGTAAAGGAGCTGAGTTCGG + Intergenic
1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG + Intergenic
1052564446 9:30129554-30129576 CAAGGTAAAAGGTCTGAGGTAGG + Intergenic
1052708493 9:32022957-32022979 TGGGGTAAAGGATGGGAGGTGGG - Intergenic
1053164732 9:35836426-35836448 GTGGGTCAAGGATCAGAGTTGGG - Intronic
1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG + Intergenic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055493320 9:76828252-76828274 CTGTGCAAAGGCACTGAGGTGGG + Intronic
1055874379 9:80924561-80924583 CTGGGCAAAGGCCCTGAGGCAGG + Intergenic
1056767289 9:89452679-89452701 GTGGGTAGATCATCTGAGGTGGG - Intronic
1057428813 9:94976192-94976214 CTGGGCAAAGGTTCTGTGGAAGG - Intronic
1058383475 9:104405964-104405986 CTGGGGAAAAGAACTGAGCTAGG - Intergenic
1058433074 9:104936224-104936246 CTTGATAATGGATCTGAGTTGGG - Intergenic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1059334087 9:113557765-113557787 CTGGGGAAAGTTTCTGAGGCAGG + Intronic
1060104321 9:120863971-120863993 CTGAGCAAAGGCTATGAGGTAGG + Intronic
1060295127 9:122338177-122338199 CGGGGCAAAGGAGCAGAGGTGGG - Intergenic
1060385866 9:123227791-123227813 GTGGGTGAATGACCTGAGGTTGG - Intronic
1061391248 9:130318382-130318404 CTGGGACAAGGACCTGAGGATGG + Intronic
1061754202 9:132801432-132801454 CTGGGAAAATGAGCAGAGGTCGG + Intronic
1062412849 9:136433565-136433587 CTGGGGGAAGGAGTTGAGGTGGG - Intronic
1185638116 X:1569978-1570000 GTGGGTAAATCACCTGAGGTTGG + Intergenic
1186001302 X:5014516-5014538 CTGGGAAACGGAGCTGAGGCAGG + Intergenic
1189388932 X:40559749-40559771 GTGGGTAAATCACCTGAGGTCGG + Intergenic
1190336805 X:49267519-49267541 CAGGGCAAAGGTCCTGAGGTGGG + Intergenic
1192180264 X:68911952-68911974 ATGGGGAAAGGGTCTGGGGTTGG - Intergenic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1194807062 X:98343108-98343130 CTGGGTAAAGCATCTTTGGCTGG + Intergenic
1195700878 X:107704718-107704740 CTGGGTAATGGATTGGATGTAGG + Intergenic
1196196217 X:112840812-112840834 CTGGGCAAAGGATGGGAGGTAGG + Intronic
1196475982 X:116087165-116087187 CTGAGTAAAGTATTTAAGGTTGG - Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199386568 X:147229902-147229924 CTGGGAACAAGATTTGAGGTAGG + Intergenic