ID: 1165476275

View in Genome Browser
Species Human (GRCh38)
Location 19:36032686-36032708
Sequence GGCGGCCCGCGGAGAAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 323}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165476275_1165476283 -2 Left 1165476275 19:36032686-36032708 CCTCCCCTTCTCCGCGGGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165476283 19:36032707-36032729 CCCCCTCCCCATCTTACCTCGGG 0: 1
1: 0
2: 3
3: 33
4: 343
1165476275_1165476295 30 Left 1165476275 19:36032686-36032708 CCTCCCCTTCTCCGCGGGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165476295 19:36032739-36032761 CTGGGGACCAAAGTGGAGACTGG 0: 1
1: 0
2: 0
3: 32
4: 271
1165476275_1165476290 11 Left 1165476275 19:36032686-36032708 CCTCCCCTTCTCCGCGGGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165476290 19:36032720-36032742 TTACCTCGGGCAGACAGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 42
1165476275_1165476294 23 Left 1165476275 19:36032686-36032708 CCTCCCCTTCTCCGCGGGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165476294 19:36032732-36032754 GACAGCGCTGGGGACCAAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 169
1165476275_1165476281 -3 Left 1165476275 19:36032686-36032708 CCTCCCCTTCTCCGCGGGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165476281 19:36032706-36032728 GCCCCCTCCCCATCTTACCTCGG 0: 1
1: 0
2: 5
3: 24
4: 272
1165476275_1165476292 13 Left 1165476275 19:36032686-36032708 CCTCCCCTTCTCCGCGGGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165476292 19:36032722-36032744 ACCTCGGGCAGACAGCGCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1165476275_1165476291 12 Left 1165476275 19:36032686-36032708 CCTCCCCTTCTCCGCGGGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165476291 19:36032721-36032743 TACCTCGGGCAGACAGCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165476275 Original CRISPR GGCGGCCCGCGGAGAAGGGG AGG (reversed) Intronic