ID: 1165477150

View in Genome Browser
Species Human (GRCh38)
Location 19:36037547-36037569
Sequence CCAGTAGTGTGCCCACAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165477150_1165477152 7 Left 1165477150 19:36037547-36037569 CCTGACTGTGGGCACACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1165477152 19:36037577-36037599 TGTGCCTCCATTTTTTCATCTGG 0: 1
1: 1
2: 16
3: 96
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165477150 Original CRISPR CCAGTAGTGTGCCCACAGTC AGG (reversed) Intronic
900919377 1:5661068-5661090 CCACTGGTGTGGCCCCAGTCTGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
903830144 1:26169755-26169777 CCAGAAGTGTGCCCACTGAAGGG - Intergenic
904238498 1:29128999-29129021 CCAGCTGTGTGACCACAGACAGG - Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904494083 1:30877043-30877065 CAAATGGTGTGCCCACAGGCTGG + Exonic
913569401 1:120105118-120105140 CCAGTGGTGTCCACACAGTGTGG + Intergenic
914290211 1:146266105-146266127 CCAGTGGTGTCCACACAGTGTGG + Intergenic
914395954 1:147268737-147268759 CCAGTAATGTGCCCTCAGTAAGG - Intronic
914551254 1:148716888-148716910 CCAGTGGTGTCCACACAGTGTGG + Intergenic
915969569 1:160344223-160344245 TCATTTGTGTGCCCACAGTGTGG - Intronic
920431925 1:205924205-205924227 CCAGGACTGTGGGCACAGTCTGG - Intronic
922404482 1:225298232-225298254 ACAGCTCTGTGCCCACAGTCAGG - Intronic
922731536 1:227950930-227950952 CCATCACTGGGCCCACAGTCAGG + Intergenic
924466649 1:244304473-244304495 CCAGCAATGTGCCAACAGACAGG - Intergenic
1062797018 10:352192-352214 CCTGTGGTTTGCCCACATTCTGG + Intronic
1063827976 10:9920327-9920349 CCAGTACAGTGCCCACACACAGG - Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1069248912 10:66244484-66244506 CCAGTGATGTGGCCACAGTGGGG + Intronic
1069321680 10:67179617-67179639 CCAGTAGTTTGACACCAGTCTGG + Intronic
1070571364 10:77641365-77641387 CCTGGAGTCTGGCCACAGTCTGG - Intergenic
1078803445 11:14670916-14670938 CCAGGAGTTTGCGCCCAGTCTGG - Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1093013333 12:14131002-14131024 TCAGTAATGTGCCCACATGCTGG - Intergenic
1095382537 12:41612735-41612757 CCAGTAGTGTGCACAAGGTGTGG - Intergenic
1097249878 12:57626646-57626668 CCAGTAGAGTGCTCACAGGGTGG + Exonic
1097339879 12:58425801-58425823 TCAGCTCTGTGCCCACAGTCAGG + Intergenic
1101659005 12:106749424-106749446 CCAGGCCTGTGCCCACTGTCAGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1105987998 13:25588545-25588567 CCAGTACTGTTCCTACAGCCAGG - Intronic
1110451703 13:75643844-75643866 CCAGTAGTATGCTCAAAGACTGG + Intronic
1110850646 13:80241173-80241195 CCAGTAGTGTGAGCCCAGTTCGG - Intergenic
1112600990 13:100855794-100855816 GCATTAATGTGACCACAGTCTGG + Intergenic
1121880953 14:97499883-97499905 TCAGCAGTGTTCCCACAGTCTGG - Intergenic
1123041778 14:105493195-105493217 CCAGTGGTGTGTCCACTGTGAGG + Intronic
1127349581 15:58137089-58137111 GCAGTAGTGTGGCCTCAGGCAGG + Intronic
1130661047 15:85831572-85831594 CCAGCACAGTGCCCACAGGCGGG + Intergenic
1131394832 15:92077917-92077939 GCAGTTGTGTGGCCACAGGCTGG + Intronic
1131426608 15:92350423-92350445 TCAGCAGTGTGCCCAGAGGCTGG + Intergenic
1132873038 16:2124068-2124090 CCAGGTGTGTGGCCACAGTACGG + Intronic
1132881181 16:2162362-2162384 CCACCACCGTGCCCACAGTCTGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134552126 16:15143247-15143269 CCAGGTGTGTGGCCACAGTACGG + Intergenic
1137540871 16:49360745-49360767 CCAGCTGTGTGCCCTCAGGCAGG - Intergenic
1140443011 16:75000877-75000899 CCAGTCATGTGCCAACAGCCAGG - Intronic
1141222604 16:82085148-82085170 CCAGGAATGATCCCACAGTCTGG - Intronic
1143251234 17:5524739-5524761 CCAGGATTCTGACCACAGTCTGG + Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1146520224 17:33520619-33520641 GCGGCAGTGAGCCCACAGTCTGG + Intronic
1151383417 17:73740943-73740965 TCAGAAGTGAGCCCAAAGTCAGG - Intergenic
1151410533 17:73924517-73924539 CCAGTAGTTTGACACCAGTCTGG - Intergenic
1151529404 17:74695046-74695068 GCAGGAGTGTGCTCACAGCCTGG + Exonic
1157953628 18:52069263-52069285 CCAGCAGAGTTCCCACAGGCTGG + Intergenic
1158465696 18:57688076-57688098 CCAGAAGTGGGCTCACAGCCAGG - Intronic
1160062464 18:75545238-75545260 ACAGAAGAGTGCCCACATTCAGG + Intergenic
1160984015 19:1829099-1829121 CCAGCAGTGTGCCCGCGGTGTGG + Intronic
1161442221 19:4298411-4298433 CCCCTAGTGAGCCCGCAGTCTGG + Intronic
1162452258 19:10762374-10762396 CCAGTGGTGTGGCCAGAGACTGG - Intronic
1162579716 19:11521631-11521653 GCAGGAGTGTGCCCCCAGCCTGG - Intronic
1165477150 19:36037547-36037569 CCAGTAGTGTGCCCACAGTCAGG - Intronic
1166328271 19:42064483-42064505 CCAGTCATGTGCCTAGAGTCTGG - Intronic
1166542463 19:43614504-43614526 CCAGCAGTGAGCACACAGTTGGG - Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168279962 19:55300262-55300284 ACAGTGCTGGGCCCACAGTCAGG - Intronic
924990636 2:309704-309726 ACAGCTGTGTGACCACAGTCAGG - Intergenic
927298668 2:21484830-21484852 CCCGGAGTGTGGCCACAGCCCGG - Intergenic
933689672 2:85170111-85170133 CCAGCAGTGTGCTCACTCTCTGG + Intronic
935620790 2:105127871-105127893 CAATCAGTGTGTCCACAGTCAGG + Intergenic
940404929 2:153289971-153289993 CCAGTTGTGTGGCCAAAGGCAGG + Intergenic
945755920 2:213846943-213846965 CCTGAAGTCTGCCCACAGCCTGG - Intronic
946962633 2:225001163-225001185 GCAGTAGTCTGGCCACATTCAGG + Intronic
947827778 2:233118033-233118055 CCAGCTGTGTGCCCACAGTCAGG - Intronic
1173855454 20:46247669-46247691 ACTGTAATGTGCCCAAAGTCAGG + Intronic
1174960178 20:55147443-55147465 CCAGTACTGTCCCCACATACCGG - Intergenic
1178537087 21:33419491-33419513 CCAGAAGTGTGACCCCAGTCTGG - Intronic
1179291513 21:40021895-40021917 TCAGCAGTTTTCCCACAGTCAGG - Intronic
1180054965 21:45352922-45352944 CCATTCCTGTGCCCACAGCCGGG + Intergenic
1180170522 21:46055858-46055880 GCAGCTGTGTGCCCACAGGCGGG + Intergenic
950390455 3:12692505-12692527 CCAGGAGTGTGAGCCCAGTCTGG + Intergenic
950459692 3:13113753-13113775 ACAGGAGTGTGCCCGCACTCTGG + Intergenic
950460668 3:13120449-13120471 CAAGCTGTGTGCCCTCAGTCAGG + Intergenic
953669062 3:44947414-44947436 CGAGTGGTGTGCCCACTGACAGG + Intronic
954411008 3:50371083-50371105 CAAGGAGTGTTCCCACAGTGTGG + Intronic
958960604 3:100506050-100506072 CCAGTAGTTTCCCCACATACAGG - Intronic
959362693 3:105414187-105414209 CCAGGAGTTTGCCACCAGTCTGG + Intronic
959494195 3:107030471-107030493 CCAGTATGCTGCCCACAGCCTGG - Intergenic
962807326 3:138936872-138936894 CCAGTTGAGTGGCCACAGTCGGG - Intergenic
968293104 3:197554331-197554353 TCTGTAGGGTGCTCACAGTCCGG - Intronic
973708103 4:53599887-53599909 TCAGTTTCGTGCCCACAGTCAGG + Intronic
975319846 4:72997528-72997550 CCCGCACTGTGCCCACAGTCTGG + Intergenic
979494315 4:121367233-121367255 GCAACATTGTGCCCACAGTCTGG + Intronic
979929911 4:126617400-126617422 CCAGAATGGTGCCCACAGACTGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
981407734 4:144391679-144391701 ACTGTCCTGTGCCCACAGTCTGG - Intergenic
982780049 4:159481216-159481238 CCACTAGTTTGCCTACAATCTGG - Intergenic
987944670 5:24589100-24589122 CCAGTATTATGCACACAGTGGGG - Intronic
991426269 5:66495287-66495309 CCAGTTGAGTTGCCACAGTCTGG - Intergenic
998092767 5:139380782-139380804 CCAGAAGTGTACCCACCTTCCGG + Exonic
1004999422 6:21225551-21225573 GAAGTAATGTGCCCACAGCCGGG - Intronic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1012849256 6:104427413-104427435 CCAGTTGAGAGCCCACATTCTGG + Intergenic
1018968908 6:168511716-168511738 CCAGCAGTGTGCACAGACTCCGG + Intronic
1020711383 7:11609660-11609682 CCTGTATTGTGACCACAGGCAGG + Intronic
1026939831 7:74281186-74281208 CCCTTGGTGTGCTCACAGTCTGG + Intergenic
1030710083 7:112739651-112739673 CCAGCTGTGTGCCTACATTCTGG - Intergenic
1032092840 7:128920244-128920266 CCAGCAGTGTCCCCACAGAGGGG - Intergenic
1032895744 7:136248889-136248911 GCAGTACTGAGCCCACAGGCAGG + Intergenic
1034981933 7:155484668-155484690 CCTGTACTGTGTCTACAGTCAGG + Intronic
1038277078 8:26130309-26130331 CCTGAAGTGTGCCCACAATGTGG + Intergenic
1039040801 8:33406772-33406794 CCAGGAGTTTGCCCTCAGCCTGG - Intronic
1049296848 8:141845322-141845344 CCAGGAATGTACCCACAGGCTGG - Intergenic
1049571001 8:143370293-143370315 CCAGAAATGACCCCACAGTCAGG + Intronic
1052859528 9:33428456-33428478 CCAGCAGTGTGGCCAGAGGCAGG + Intergenic
1055917738 9:81423600-81423622 CCAGTAGTGTTGAGACAGTCAGG - Intergenic
1056538582 9:87552158-87552180 CCAGTAGGGAGCCCAGAGCCTGG + Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1056753580 9:89368482-89368504 CCAGAAGGGTCCCCAGAGTCTGG - Intronic
1059402239 9:114077653-114077675 CCAGGTGTCTGTCCACAGTCAGG + Intronic
1189901270 X:45709134-45709156 CAAGTAGTATGCCCGCAGTATGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1192211402 X:69130174-69130196 GAAGTTGTATGCCCACAGTCAGG + Intergenic
1193373951 X:80735249-80735271 CCAGTAGTGCGCTAACATTCTGG - Intronic
1195090675 X:101455761-101455783 CAAGTACTGTGCTCACAATCTGG - Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1199036150 X:143053156-143053178 CCAGAAGGGAGCCCACTGTCTGG - Intergenic
1200315091 X:155124169-155124191 CCAGTAGTTTGCCACCAGCCTGG - Intronic
1201372255 Y:13278400-13278422 GCACTAGTGTGGCCACAGTTGGG + Intronic
1202071339 Y:20994758-20994780 CCGGTAGTGTGTACACAGTGTGG - Intergenic