ID: 1165479493

View in Genome Browser
Species Human (GRCh38)
Location 19:36054280-36054302
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 0, 2: 5, 3: 81, 4: 927}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479493_1165479505 8 Left 1165479493 19:36054280-36054302 CCGCCTAACCCCGCCCCACCCGC 0: 1
1: 0
2: 5
3: 81
4: 927
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479493_1165479509 27 Left 1165479493 19:36054280-36054302 CCGCCTAACCCCGCCCCACCCGC 0: 1
1: 0
2: 5
3: 81
4: 927
Right 1165479509 19:36054330-36054352 GTGGAGTCTCGTCACGTACCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1165479493_1165479510 28 Left 1165479493 19:36054280-36054302 CCGCCTAACCCCGCCCCACCCGC 0: 1
1: 0
2: 5
3: 81
4: 927
Right 1165479510 19:36054331-36054353 TGGAGTCTCGTCACGTACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1165479493_1165479508 26 Left 1165479493 19:36054280-36054302 CCGCCTAACCCCGCCCCACCCGC 0: 1
1: 0
2: 5
3: 81
4: 927
Right 1165479508 19:36054329-36054351 CGTGGAGTCTCGTCACGTACCGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479493 Original CRISPR GCGGGTGGGGCGGGGTTAGG CGG (reversed) Exonic