ID: 1165479494 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:36054283-36054305 |
Sequence | AGCGCGGGTGGGGCGGGGTT AGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 522 | |||
Summary | {0: 1, 1: 0, 2: 7, 3: 46, 4: 468} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1165479494_1165479505 | 5 | Left | 1165479494 | 19:36054283-36054305 | CCTAACCCCGCCCCACCCGCGCT | 0: 1 1: 0 2: 7 3: 46 4: 468 |
||
Right | 1165479505 | 19:36054311-36054333 | CCTGCCTCACGTGACGTCCGTGG | 0: 1 1: 0 2: 0 3: 3 4: 39 |
||||
1165479494_1165479509 | 24 | Left | 1165479494 | 19:36054283-36054305 | CCTAACCCCGCCCCACCCGCGCT | 0: 1 1: 0 2: 7 3: 46 4: 468 |
||
Right | 1165479509 | 19:36054330-36054352 | GTGGAGTCTCGTCACGTACCGGG | 0: 1 1: 0 2: 0 3: 0 4: 15 |
||||
1165479494_1165479508 | 23 | Left | 1165479494 | 19:36054283-36054305 | CCTAACCCCGCCCCACCCGCGCT | 0: 1 1: 0 2: 7 3: 46 4: 468 |
||
Right | 1165479508 | 19:36054329-36054351 | CGTGGAGTCTCGTCACGTACCGG | 0: 1 1: 0 2: 0 3: 0 4: 7 |
||||
1165479494_1165479510 | 25 | Left | 1165479494 | 19:36054283-36054305 | CCTAACCCCGCCCCACCCGCGCT | 0: 1 1: 0 2: 7 3: 46 4: 468 |
||
Right | 1165479510 | 19:36054331-36054353 | TGGAGTCTCGTCACGTACCGGGG | 0: 1 1: 0 2: 0 3: 1 4: 13 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1165479494 | Original CRISPR | AGCGCGGGTGGGGCGGGGTT AGG (reversed) | Exonic | ||