ID: 1165479494

View in Genome Browser
Species Human (GRCh38)
Location 19:36054283-36054305
Sequence AGCGCGGGTGGGGCGGGGTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 468}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479494_1165479505 5 Left 1165479494 19:36054283-36054305 CCTAACCCCGCCCCACCCGCGCT 0: 1
1: 0
2: 7
3: 46
4: 468
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479494_1165479509 24 Left 1165479494 19:36054283-36054305 CCTAACCCCGCCCCACCCGCGCT 0: 1
1: 0
2: 7
3: 46
4: 468
Right 1165479509 19:36054330-36054352 GTGGAGTCTCGTCACGTACCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1165479494_1165479508 23 Left 1165479494 19:36054283-36054305 CCTAACCCCGCCCCACCCGCGCT 0: 1
1: 0
2: 7
3: 46
4: 468
Right 1165479508 19:36054329-36054351 CGTGGAGTCTCGTCACGTACCGG 0: 1
1: 0
2: 0
3: 0
4: 7
1165479494_1165479510 25 Left 1165479494 19:36054283-36054305 CCTAACCCCGCCCCACCCGCGCT 0: 1
1: 0
2: 7
3: 46
4: 468
Right 1165479510 19:36054331-36054353 TGGAGTCTCGTCACGTACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479494 Original CRISPR AGCGCGGGTGGGGCGGGGTT AGG (reversed) Exonic