ID: 1165479499

View in Genome Browser
Species Human (GRCh38)
Location 19:36054294-36054316
Sequence GGCAGGCGGCGAGCGCGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479499_1165479505 -6 Left 1165479499 19:36054294-36054316 CCCACCCGCGCTCGCCGCCTGCC 0: 1
1: 0
2: 1
3: 32
4: 244
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479499_1165479509 13 Left 1165479499 19:36054294-36054316 CCCACCCGCGCTCGCCGCCTGCC 0: 1
1: 0
2: 1
3: 32
4: 244
Right 1165479509 19:36054330-36054352 GTGGAGTCTCGTCACGTACCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1165479499_1165479510 14 Left 1165479499 19:36054294-36054316 CCCACCCGCGCTCGCCGCCTGCC 0: 1
1: 0
2: 1
3: 32
4: 244
Right 1165479510 19:36054331-36054353 TGGAGTCTCGTCACGTACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1165479499_1165479508 12 Left 1165479499 19:36054294-36054316 CCCACCCGCGCTCGCCGCCTGCC 0: 1
1: 0
2: 1
3: 32
4: 244
Right 1165479508 19:36054329-36054351 CGTGGAGTCTCGTCACGTACCGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479499 Original CRISPR GGCAGGCGGCGAGCGCGGGT GGG (reversed) Exonic
900138531 1:1128985-1129007 GGCAGGCGGAGCCCGCGGGGAGG + Intergenic
900221647 1:1512358-1512380 GGGCGGCGGGGACCGCGGGTTGG + Exonic
900227566 1:1540231-1540253 GCCAGGCGGCGCGCGCGGGCGGG + Intronic
900265629 1:1755737-1755759 GGGAGCTGGCGAGGGCGGGTGGG + Intronic
900412676 1:2520031-2520053 GGCAGGAGGCACGCGCGGGCAGG + Intronic
901055982 1:6448814-6448836 GGCAGCCGGCGCGCGCGGGCTGG - Exonic
902478413 1:16699825-16699847 GGCAGCCGGCGGGCGCGGGCTGG + Intergenic
903349950 1:22711327-22711349 CGGGGGCGGCGAGCGCGCGTGGG - Intronic
903750154 1:25616636-25616658 GGCAGAGGCCGAGCGCGGGCGGG - Intergenic
903879661 1:26500392-26500414 GGGAGGCGGCGCCCGCGGGATGG + Intergenic
904181375 1:28668913-28668935 GGCGGCCGGCGAGGGCGGGCGGG + Intronic
906130762 1:43453852-43453874 GGCGGGCGGCGGGCGGGGGCGGG + Exonic
907012674 1:50978056-50978078 GGCAGGAGGCGGGAGCGGGGGGG + Intergenic
910182984 1:84505959-84505981 GGAAGGCGGCGGCGGCGGGTGGG - Intronic
912514668 1:110210406-110210428 GGCAGGGGGCGGGCGCGAGGTGG - Intergenic
912801590 1:112722937-112722959 GGCTGGAGGCCAGCCCGGGTGGG + Intronic
916694356 1:167221215-167221237 GGCAGACGGCGAGCGGCGGCGGG - Intronic
916899276 1:169202965-169202987 GGCAGGCGGGCAGGGAGGGTGGG + Intronic
918114153 1:181482802-181482824 GGCGGGCGGCGAGCACCGGCGGG - Intronic
918272848 1:182920037-182920059 GGCAGGGTGCCAGCGAGGGTGGG - Intronic
920912558 1:210232572-210232594 GGCAGGGGGCGGGCTGGGGTGGG + Intergenic
922917648 1:229271383-229271405 GGCTGGCGGGGCGCGCGGGTCGG + Intronic
923782938 1:237042222-237042244 TGCAGGCAGCGAGCGCGGCTGGG + Exonic
1065102124 10:22341075-22341097 AGCAGGCCGGGAGCGCGGGCGGG - Intergenic
1066221183 10:33336762-33336784 GGGAGGCGGCGACCGCGCGCGGG - Intergenic
1067806409 10:49395996-49396018 GGCTGGCGGCGGGCGGGGCTCGG + Intronic
1070390651 10:75967759-75967781 GGGAGGCGGCGGGCAGGGGTGGG + Intronic
1072107875 10:92291250-92291272 GGGAGGCGGCGATCGCGGCCCGG - Exonic
1072757743 10:98031477-98031499 CGCAGGCGGCAGGAGCGGGTGGG - Intergenic
1073250984 10:102120205-102120227 GGCCGGCGGCGAGCGCAGCGGGG - Exonic
1074377494 10:112951641-112951663 GGCGGGCGGCGCGGGCGGGCGGG - Intronic
1075801852 10:125159416-125159438 GCCGGGCGGCGGGCGCGGGCGGG - Intronic
1077060086 11:614136-614158 GGGAGGGGGGGAGCGCGGGAGGG - Intronic
1078174969 11:8963817-8963839 GGCTGGCGGAGGGCGCAGGTGGG + Intronic
1081023697 11:37981861-37981883 AGCAGGAGGTGAGCGTGGGTGGG + Intergenic
1083207558 11:61161641-61161663 GGCGTGCGGCGAGCGCTGGAGGG - Intergenic
1083623148 11:64058830-64058852 GGCAGCCGGCAAGGGGGGGTAGG + Intronic
1084480356 11:69416250-69416272 GGCAGGCGGCGTGTGCAGGTTGG + Intergenic
1084606421 11:70175005-70175027 GGCAGGTGGCGGGCGGGGGTGGG - Intronic
1088699251 11:112397473-112397495 GGCAGGGGGCTAGGGCAGGTTGG + Intergenic
1089185946 11:116614774-116614796 GGCAGTCTGTGAGCGGGGGTGGG - Intergenic
1089208919 11:116787910-116787932 GGCAGGCGGCGGGGCCGGGGCGG + Exonic
1089457659 11:118634820-118634842 GGCGGGAGGGGAGCGCGGGAGGG - Intronic
1089966157 11:122656242-122656264 GGCCGGCCGCGCGCGCGGGAGGG - Intronic
1090293918 11:125569650-125569672 GGCAGGGCCCGAGCGTGGGTTGG + Intronic
1090799194 11:130160053-130160075 GGCACGAGGTGAGCGCGGGCCGG + Exonic
1091239334 11:134042057-134042079 GGCAGGCGGGGAGCGGAGCTCGG + Intergenic
1091259734 11:134224810-134224832 GGCAGTGGGCGGGCGAGGGTCGG - Exonic
1091616371 12:2053670-2053692 GGGCCGCGGGGAGCGCGGGTAGG - Intronic
1092256260 12:6928120-6928142 GGGAGGCGGCGAGCCCGGGGAGG + Intronic
1093958832 12:25251074-25251096 GGGAGGCAGCGAGCGCCGGCGGG + Intergenic
1095465515 12:42484110-42484132 GGCAGGCGCCGCCCGCGGGCGGG - Intronic
1096178650 12:49538999-49539021 TGCAGGCGGCGGGCGCGGGAGGG + Intergenic
1096435907 12:51591094-51591116 GGCAGGGGGCGCGCGCGGAGGGG + Intronic
1096769814 12:53927894-53927916 GGAAGGCGGGGAGCGCTGGGCGG + Intergenic
1096784409 12:54009039-54009061 GGCGGGCGGCGAGCGGGCGGCGG - Intronic
1096841151 12:54379774-54379796 GGCAGGTGGCGGGCGCGGGTAGG - Intronic
1097287332 12:57888308-57888330 GGGAGGCGGGGAGCTCGGGAAGG + Intergenic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1102453483 12:113057444-113057466 GGCAGGTCGCGAGCACGAGTGGG + Intronic
1103034583 12:117646466-117646488 GGGAGGCTGCGAGCCCCGGTAGG - Intronic
1103527831 12:121579486-121579508 GGCGGGCGGCGGGGGCGGCTGGG - Intronic
1103914009 12:124367213-124367235 GGCAGGGGGTGAGCGGGGGCAGG + Intronic
1105472285 13:20704379-20704401 GGCAGGCGGGGAGGGTGGGGCGG + Intronic
1106208472 13:27620741-27620763 GGCGGGCGGCGAGGGCGGAGTGG - Intronic
1106735917 13:32587130-32587152 GGCGGGCGGGGACCGCGGGTCGG + Intronic
1107118829 13:36776597-36776619 GGCTGGGGGCGGGTGCGGGTGGG - Intergenic
1107604048 13:42040856-42040878 GGCGGCCGGCGGGCGCGGGCTGG + Intronic
1113517416 13:110914515-110914537 GGCAGCCGGGGGGCGCGGGGCGG - Intronic
1115399417 14:32939806-32939828 GGAAGGCGGCGAGCAGGGGGAGG + Intronic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1117135340 14:52730093-52730115 GGCAGAAGGCGAGCGTGGGCTGG + Intergenic
1118992609 14:70809623-70809645 GGAAGGCAGCGGGCGCGGGGCGG - Intergenic
1119046296 14:71321016-71321038 GGCGGGCGCCGAGCGCGGAGCGG - Intronic
1119382865 14:74239914-74239936 GCCAGACGGCCAGCTCGGGTAGG + Exonic
1120167876 14:81220304-81220326 GCCGGGCGGCGGGCGCGGGGGGG - Intronic
1121013390 14:90534644-90534666 GGCAGGGGCCGAGCGCTGGGAGG + Exonic
1122082115 14:99273507-99273529 TGGAGGCGGCCAGGGCGGGTCGG + Intergenic
1122221000 14:100239122-100239144 GGAAGGCGGCGAGCGGGCGGGGG - Exonic
1122888112 14:104719527-104719549 GGCAGGGGGCAGGCTCGGGTAGG - Exonic
1123684397 15:22786853-22786875 GGCAGGCGGCGGGCGGGTGGGGG + Intronic
1125070281 15:35546159-35546181 TGCGTGCGGCGAGCGCGGGCGGG + Exonic
1125541178 15:40471011-40471033 GGCGGGCGGCGGGCGCGGCGAGG - Exonic
1127072574 15:55300732-55300754 GGCAGGGGGCGAGGGCAGGATGG + Intronic
1127267957 15:57376441-57376463 GGCGGGCGGCGACTGCGGGGCGG + Intronic
1128236493 15:66071152-66071174 GGCAGGAGGTGAGGGCGGGGAGG - Intronic
1129453028 15:75661288-75661310 GGCAGGCGGGCAGGGCGGGCTGG - Exonic
1129763965 15:78149463-78149485 GGCAGGCCGCGAGGGCTGGCAGG + Intronic
1130247140 15:82262494-82262516 GGCTGGGGCCGAGCGCGGGCTGG - Intronic
1130453489 15:84080424-84080446 GGCTGGGGCCGAGCGCGGGCTGG + Intergenic
1130869455 15:87958983-87959005 GGGGGGCGGGGAGCGGGGGTGGG - Intronic
1131096067 15:89655065-89655087 TGGAGGCGGCGGGCGCGGGACGG + Intronic
1131517616 15:93089327-93089349 GGCGGGGGGCGCGCGCGGGCGGG + Intergenic
1132163932 15:99566350-99566372 GGGAGGCGGCGAGGGGTGGTCGG + Intronic
1132482388 16:173028-173050 GGCGGGCGAGGAGCCCGGGTCGG - Intronic
1132483236 16:176832-176854 GGCGGGCGAGGAGCCCGGGTCGG - Intronic
1132873235 16:2124760-2124782 GTGAGGCGGCCAGCGCGGGCGGG - Intronic
1132889454 16:2196654-2196676 GGCGCGCGGCGGGCGCGGGGCGG + Intergenic
1134070176 16:11255830-11255852 AGCAGGCGGCGGGCGCGGGGCGG - Intronic
1134134133 16:11668554-11668576 GGCAGGCCGCGCGCTCGGGCCGG + Intronic
1134552323 16:15143939-15143961 GTGAGGCGGCCAGCGCGGGCAGG - Intergenic
1139529797 16:67537537-67537559 CGCGGGGGGCGAGCGCGGGTCGG + Intronic
1140280160 16:73546494-73546516 GGCGGGGGGCGGGGGCGGGTAGG + Intergenic
1141054750 16:80804559-80804581 GGCCGGCGGCGGGCGCCGGGCGG - Intergenic
1141556883 16:84842282-84842304 GGCAGGCGGGGAGGGAGGGAGGG - Intronic
1142429750 16:90019575-90019597 AGCAGGGGGCGCGCGCGGGCCGG - Intronic
1144787615 17:17840594-17840616 GGCAGGCGTCCAGCACGGGCAGG + Intergenic
1144854168 17:18258792-18258814 GGAATGCGGCGGGCGCGGGCGGG - Exonic
1146179377 17:30687542-30687564 GGCAGGCGCGGGGCGGGGGTGGG - Intergenic
1146256012 17:31391855-31391877 GGCGGGCGGCGCGGGCTGGTCGG + Exonic
1146271440 17:31488193-31488215 GGAAGCCAGCGGGCGCGGGTCGG - Intronic
1146445204 17:32927879-32927901 CCCAGGCGGCGAGCGCGGATGGG - Intergenic
1147110357 17:38257109-38257131 AGCAGGCGGCGAGCGAGGGAGGG + Intergenic
1147179515 17:38675131-38675153 GGGAGGGAGCGTGCGCGGGTGGG + Exonic
1148128238 17:45247755-45247777 GGCAGGCGAGGAGCGGGGGCAGG - Intergenic
1148146418 17:45367714-45367736 GGCAGGCGGGGAGAGGGGGGAGG + Intergenic
1148419153 17:47531322-47531344 AGCAGGCGGCGAGCGAGGGAGGG - Exonic
1148456407 17:47813783-47813805 GGCAGGCAGCGACGGCGGGGTGG + Exonic
1149575212 17:57707147-57707169 GGCAGGCAGGGAGCTCAGGTAGG - Intergenic
1150108271 17:62478162-62478184 GGGAGCCCGCGAACGCGGGTGGG + Intronic
1151293329 17:73165732-73165754 GGCAGGCGGCGGGCGCAGAGCGG + Intronic
1151491032 17:74432444-74432466 GGCGGGGGGCGGGCGGGGGTGGG - Intronic
1151570639 17:74923771-74923793 GGCCGGCGGCGGGGGCGGGCAGG + Intergenic
1151660718 17:75516650-75516672 GGCGCGGGGCCAGCGCGGGTAGG + Intronic
1152023248 17:77792822-77792844 GGCAGGCCGTGAGAGTGGGTGGG - Intergenic
1152259813 17:79260844-79260866 GGCAGTCGGCCAGAGCTGGTGGG - Intronic
1152328957 17:79659506-79659528 GGCAGGTGGGGAGCGAGAGTGGG + Intergenic
1152466711 17:80470770-80470792 AGCAGGGGGCGAGGGCGGGCGGG + Exonic
1153480620 18:5543474-5543496 GGCTGGGGGCGAGCGCGGGCCGG - Intronic
1155963913 18:32018751-32018773 GGGAGGCGGCGATCGCAGCTGGG + Exonic
1156171843 18:34494365-34494387 GGGGGGCGGCGGGGGCGGGTGGG + Intronic
1158152971 18:54393218-54393240 GGCAGGCGGGGAGCGGGGGGTGG + Intergenic
1160873053 19:1285765-1285787 GGCAGGGGGCGGGCGCAGGCTGG + Intergenic
1160906019 19:1452069-1452091 GGGAGGAGGCGAGCGCTGATGGG + Exonic
1160980840 19:1815885-1815907 GGCAGGACGTGAGCGGGGGTGGG + Exonic
1161108779 19:2456969-2456991 GGCGGGCGGCGGGCGCGGCGCGG - Exonic
1161532815 19:4800398-4800420 GGCAGTCGGCGAGCTTGGGGGGG - Exonic
1161849742 19:6732159-6732181 CGCAGGCGGCGGGGGTGGGTGGG + Intronic
1162550517 19:11355693-11355715 GGGAGGCGGCGAGCTGGGGGAGG + Intronic
1162909907 19:13842982-13843004 GGCAGGGGGCGGGCGCGGGGCGG + Intergenic
1163663945 19:18594472-18594494 GGCAGGGGGTGCGCGCGGGCAGG + Intronic
1163793350 19:19321128-19321150 AGAAGGCGGTGAGCGCGGGCCGG + Exonic
1163807055 19:19405831-19405853 GGCCGGCGGCGCGGGCGGGCGGG + Intronic
1164713479 19:30375446-30375468 GGCCGGGGGCGCGCCCGGGTCGG - Intronic
1164834886 19:31350206-31350228 GGGAGGAGGCGGGCGCGGGCCGG + Intergenic
1165479499 19:36054294-36054316 GGCAGGCGGCGAGCGCGGGTGGG - Exonic
1166094445 19:40530420-40530442 GGCAGGGGGCGCACGCGGGCGGG + Intronic
1166105931 19:40598114-40598136 GCCAGGCGGGGAGGGTGGGTGGG - Intronic
1166721798 19:45001420-45001442 GGCGGGCGGCGGGCGGGGGCGGG - Exonic
1166947382 19:46405345-46405367 GAGAGGCGGGGAGCGGGGGTTGG - Intergenic
1167071752 19:47226188-47226210 GGCAGGGGGCGGGCGCGGCGCGG + Intronic
1167596745 19:50432168-50432190 GGCAGGCACCGGACGCGGGTAGG - Intergenic
1168113446 19:54207926-54207948 GGCAGGCGCCGAGTGGAGGTGGG + Intronic
1202712432 1_KI270714v1_random:25656-25678 GGCAGCCGGCGGGCGCGGGCTGG + Intergenic
927125962 2:20012600-20012622 GGGAGGCGGCGCGCGGGGGCCGG + Exonic
927464876 2:23329381-23329403 AGCTGGCGGCGAGGACGGGTGGG + Intergenic
927809296 2:26172949-26172971 GTCCGGCGGCGAGTCCGGGTCGG + Intergenic
930096839 2:47571695-47571717 GGGAGGAGTCAAGCGCGGGTAGG + Intergenic
931517624 2:63059186-63059208 GGCAGGCGGCCAGGGCGAGGAGG + Intergenic
934014652 2:87866832-87866854 GGCAGGAGGGGATGGCGGGTGGG - Intergenic
934716794 2:96549332-96549354 GGCAGGCGGGGAGCGGGAGGAGG + Exonic
934951269 2:98577157-98577179 GGCAGGCGGGGCGCGCGGCCTGG - Intronic
937906079 2:127053522-127053544 GGCCTGGGGCGAGCGGGGGTAGG - Intronic
940420792 2:153477875-153477897 GGCAGGTGGAGAGGGCGGGCAGG - Exonic
940453738 2:153871874-153871896 GGGAGGCGGCGGGCTGGGGTGGG + Intergenic
946246578 2:218391280-218391302 ACCAGGGGGTGAGCGCGGGTGGG + Exonic
947718255 2:232352473-232352495 GGAAGGAGGGGAGCGCGGGGCGG - Intergenic
948115860 2:235494075-235494097 GGCAGGCGGCGGGCGGCGCTCGG + Intronic
1169371334 20:5030514-5030536 GGCAGGCAGTGAGTGGGGGTGGG + Intergenic
1169405276 20:5316768-5316790 GGCAGGCGGGGACCCCGGGGCGG - Intergenic
1170578596 20:17681890-17681912 GGCAGGCGGCGGGCGGCGGGCGG + Intronic
1171346435 20:24469567-24469589 CGCAGGCGGAGAGCGCAGGGCGG + Exonic
1175199198 20:57266390-57266412 GTGAGGAGGCGGGCGCGGGTGGG + Exonic
1175955059 20:62604955-62604977 GGCAGGTGGCATGCACGGGTGGG - Intergenic
1178416978 21:32412391-32412413 GGCACCCGGCCAGCGCGGGCAGG + Exonic
1178525395 21:33324568-33324590 TGCAGTCGGAGGGCGCGGGTGGG - Intronic
1179512047 21:41879476-41879498 GGCAGCGGGCGCGCGCGGGGCGG + Exonic
1179674902 21:42974734-42974756 GGCGGGCGGCGGCCGCGGGCCGG - Intronic
1179720922 21:43315651-43315673 GGCAGGCGGCTAGTGAGGGATGG + Intergenic
1180064293 21:45405055-45405077 GGCAGGGGGCGGGCGCGGGGCGG - Intergenic
1180190746 21:46161355-46161377 GCAAGGCGGCGGGCGCGGGGCGG + Exonic
1182435444 22:30326882-30326904 CTCAGGCGGCGGGCGCGGCTGGG - Exonic
1183642640 22:39101600-39101622 GGCGGGGGGCGGGGGCGGGTTGG + Intronic
1183642670 22:39101662-39101684 GGCGGGGGGCGGGGGCGGGTTGG + Intronic
1185321383 22:50201600-50201622 GGCGGGCGAGGGGCGCGGGTGGG + Intronic
1185372684 22:50468324-50468346 GGCAGGTGGGGAGGGCAGGTGGG - Intronic
950282654 3:11720358-11720380 GGCCGTCGGGGAGCGCGGCTCGG - Intronic
950549103 3:13655551-13655573 GGCAGGCGGCCGGCGCGGATGGG - Intergenic
953912183 3:46898817-46898839 GGCAGGCGGCGGGGGCGCCTGGG - Exonic
954404445 3:50337632-50337654 GGCCGGAGGCGAGGGCGGGAAGG + Intronic
954469010 3:50675417-50675439 GGCGCGGGGCGAGCGCGGGGTGG + Intronic
954763952 3:52897486-52897508 GGCAGGCAGCGAGGCCGGGCGGG - Exonic
956675090 3:71725470-71725492 GGCGGGCGGCTAGCCCGGGGCGG - Intronic
960926063 3:122795588-122795610 GGCAGGCCTGGAGCGCGGGCAGG - Intronic
961521050 3:127467544-127467566 TGCAGCAGGCGAGCGGGGGTGGG - Intergenic
966182167 3:177197392-177197414 GGGAGGCGGCGCGCGGGGGAAGG + Intronic
967171814 3:186827666-186827688 GGCAGCCGGCGCTGGCGGGTGGG - Intergenic
968135402 3:196216645-196216667 GGCAGGCGGGGCGGGCAGGTGGG - Exonic
968319084 3:197749888-197749910 GGCGGGCTGCGTGCGCGAGTGGG + Exonic
968471916 4:786354-786376 GGGAGGCGGCGGGCGCGGGCAGG + Exonic
968498348 4:931662-931684 GGCAGGCAGGGAGCTTGGGTGGG - Intronic
968573693 4:1355253-1355275 GGCAGGCGGCGAGCGGGAAGGGG + Intronic
969113887 4:4859763-4859785 GGCGGGAGGCGCGCGCGGGAGGG + Exonic
970251016 4:14116164-14116186 GGCAGGAGGTGAGAGTGGGTGGG + Intergenic
971405622 4:26319473-26319495 GGCGGGCGGCGGGCGCGGGCGGG - Intronic
973279284 4:48341961-48341983 GTCGGGCGGCGGGCCCGGGTCGG + Exonic
976431315 4:84966214-84966236 GGCCGGCGGAGGGCGCGGGCGGG + Exonic
977744861 4:100534886-100534908 GGCAGGAGACGAGAGGGGGTAGG - Intronic
980463562 4:133148215-133148237 GGGCGGCGGCGAACGCGGGCGGG - Intergenic
981713591 4:147732160-147732182 GGCGCGCGGCGAGCGCGGCACGG - Exonic
984146364 4:176065967-176065989 AGCAGGCGGGGAGGGCGGGGAGG + Exonic
985769698 5:1801296-1801318 TGGGGGCGGGGAGCGCGGGTCGG - Intronic
990428587 5:55712492-55712514 GGCAGCCGGCGCGCCCAGGTGGG + Exonic
990978134 5:61576931-61576953 GGCAGGCGGGGAGTACAGGTGGG + Intergenic
997253673 5:132410823-132410845 GGCGCGCGGCGGGCGCGGGCCGG - Intronic
1002896327 6:1382408-1382430 GGCAGGCGGAGAGGGCGAGGGGG + Intergenic
1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG + Intergenic
1004497666 6:16180347-16180369 AGCAGGCTGCGGGCGGGGGTGGG - Intergenic
1008920873 6:56843475-56843497 GGCGTGCGGCGAGGGCGGGCGGG + Intronic
1009379653 6:63011249-63011271 GGCAGGCGGGGAGGGGGGGTAGG - Intergenic
1011443081 6:87408136-87408158 GCCAGGCGGCGAGCTTGGGGCGG + Intronic
1012472918 6:99590890-99590912 TGCAGGGCGCGAGCGCGGGGCGG + Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013441761 6:110179097-110179119 GGCGGACCGCGGGCGCGGGTGGG + Intronic
1017158222 6:151341510-151341532 GGCTGGCGCCGGGCGCGGGGAGG + Intronic
1018067063 6:160131628-160131650 GGCGGGTGGGGAGCGTGGGTGGG + Intronic
1018383769 6:163284695-163284717 GGGAGGCGGGGAGCGGGGGTTGG - Intronic
1019474298 7:1236622-1236644 GGCAGGCGGCGCGGGCGGCACGG - Exonic
1019563877 7:1670354-1670376 GGTAAGCGGCGAGCGCGGCCGGG + Intergenic
1019564967 7:1674634-1674656 GGCAGACGTCGAGGGCGGGGGGG - Intergenic
1019681917 7:2355163-2355185 GGCCGGCGGCGAGGGCGACTCGG - Exonic
1020012659 7:4815241-4815263 GGGAGGCGGCGAGTGTGGGGAGG - Intronic
1020079088 7:5276907-5276929 GGCAGGCGGCAAGGGCTGGGTGG + Intronic
1021411328 7:20331771-20331793 GTCAGGCGGCGGGCGCGGGGCGG + Exonic
1021466058 7:20944686-20944708 GCCAGGAGGCCAGTGCGGGTGGG + Intergenic
1021868646 7:24981656-24981678 GGCAGGCGGCGGGCGAGGGCGGG + Intergenic
1023838518 7:44082407-44082429 AAACGGCGGCGAGCGCGGGTCGG - Exonic
1023849963 7:44145044-44145066 GCCAGGCTGCGAGCACGTGTGGG + Exonic
1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG + Exonic
1026843302 7:73683004-73683026 GGTACGCGGCGAGCCGGGGTCGG + Exonic
1028985597 7:97006304-97006326 GGTAGGCGGCGAGCGAGCGGTGG - Exonic
1029640694 7:101817228-101817250 GGCGCGCGGCGATCGCGGCTCGG - Intronic
1032037316 7:128530696-128530718 GGGAGCCCGCGAACGCGGGTGGG + Intergenic
1034192969 7:149225256-149225278 GGTAGGCGGAGAGCGCGGTTGGG - Exonic
1035251864 7:157603138-157603160 GGCAGGTGGCGGGGGCGGGATGG - Intronic
1036786754 8:11692885-11692907 GGCTGGAGGCGAGCGCGGGGCGG - Intronic
1037313137 8:17577170-17577192 GGGAGGCGGCGGGCGAGGGGCGG - Exonic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1039554722 8:38467845-38467867 GGCGGGCGGCGAGCGGAGGGAGG + Exonic
1045432202 8:102124353-102124375 GGGAGGCGGCGAGCCAGGCTGGG - Intronic
1047499184 8:125429404-125429426 GGCGGGCGGCAGGCGCGGGGGGG + Intergenic
1047780784 8:128109343-128109365 GGCTGGCGGCGAGCTCGCCTAGG - Intergenic
1048972841 8:139654876-139654898 GGCAGGCGGCTAGAGAGAGTGGG + Intronic
1049376113 8:142289973-142289995 GGCAGGCAGCTAGCATGGGTGGG + Intronic
1049471882 8:142778572-142778594 AGCAGGAGGCGAGCGCTGGCGGG - Intergenic
1050091079 9:2016692-2016714 GGGAGGCGGGGAGACCGGGTAGG + Intronic
1050175249 9:2863529-2863551 GGGAGGCGGGGGGCGCTGGTGGG + Intergenic
1050731331 9:8713283-8713305 GGGTGGCGGCGAGCGCGGAGAGG + Intronic
1055512808 9:77012157-77012179 GGCAGGCTGCGGGCGCCGGGAGG - Intergenic
1056766392 9:89447081-89447103 GGCAGCGGGCGAGGGAGGGTCGG - Intronic
1056992007 9:91421521-91421543 GGCGGGCGGGGACCTCGGGTCGG - Intronic
1057075621 9:92136751-92136773 GGCAGGGGGCCAGCGTGGGCTGG + Intergenic
1059305296 9:113349438-113349460 GGCGGGATGGGAGCGCGGGTTGG + Intergenic
1059372261 9:113851612-113851634 GGCGGGCGGCCAGCGTGGCTGGG - Intergenic
1060477938 9:123999659-123999681 GGGCGGCGGCGAGCGCCGGGAGG - Intergenic
1060849265 9:126860889-126860911 GGCAGGCGGCCGGCGCGGGCGGG + Intronic
1061959638 9:133981477-133981499 GGCAGGCGGCGGGTGAGGGCCGG + Intronic
1062022516 9:134326222-134326244 GGCGGGCGGCGATCGCGGGGCGG + Intronic
1062653489 9:137590303-137590325 GGGAGGCGCCGAGCGGGGGCCGG + Exonic
1203781918 EBV:105577-105599 GGAAGGCGGCGAGGGAGGGGGGG - Intergenic
1186496445 X:10015529-10015551 AGGAGGCGGCGCGCGCGGGGCGG + Intergenic
1187698189 X:21941177-21941199 CGAAGGCGGCGAGCCCGCGTGGG - Intronic
1192147826 X:68693753-68693775 GGCAGGAGGCGAGCCCAGGAGGG - Intronic
1192237552 X:69305707-69305729 GGCAGGCGGCGAGGCCGCGCCGG - Intergenic
1195278859 X:103310534-103310556 GGCGGGGGGCGAGAGCGGCTAGG - Intronic
1199129826 X:144171679-144171701 GGCAGGAGGGGATGGCGGGTGGG + Intergenic
1199724753 X:150568908-150568930 GGCCGGCGGCGGGCGAAGGTCGG + Intronic
1200036468 X:153334591-153334613 GGGGGGCGGCGATCCCGGGTGGG + Intronic