ID: 1165479502

View in Genome Browser
Species Human (GRCh38)
Location 19:36054299-36054321
Sequence CGTGAGGCAGGCGGCGAGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479502_1165479509 8 Left 1165479502 19:36054299-36054321 CCGCGCTCGCCGCCTGCCTCACG 0: 1
1: 0
2: 2
3: 21
4: 166
Right 1165479509 19:36054330-36054352 GTGGAGTCTCGTCACGTACCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1165479502_1165479510 9 Left 1165479502 19:36054299-36054321 CCGCGCTCGCCGCCTGCCTCACG 0: 1
1: 0
2: 2
3: 21
4: 166
Right 1165479510 19:36054331-36054353 TGGAGTCTCGTCACGTACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1165479502_1165479508 7 Left 1165479502 19:36054299-36054321 CCGCGCTCGCCGCCTGCCTCACG 0: 1
1: 0
2: 2
3: 21
4: 166
Right 1165479508 19:36054329-36054351 CGTGGAGTCTCGTCACGTACCGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479502 Original CRISPR CGTGAGGCAGGCGGCGAGCG CGG (reversed) Exonic