ID: 1165479503

View in Genome Browser
Species Human (GRCh38)
Location 19:36054308-36054330
Sequence CGGACGTCACGTGAGGCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479503_1165479510 0 Left 1165479503 19:36054308-36054330 CCGCCTGCCTCACGTGACGTCCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1165479510 19:36054331-36054353 TGGAGTCTCGTCACGTACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1165479503_1165479509 -1 Left 1165479503 19:36054308-36054330 CCGCCTGCCTCACGTGACGTCCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1165479509 19:36054330-36054352 GTGGAGTCTCGTCACGTACCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1165479503_1165479508 -2 Left 1165479503 19:36054308-36054330 CCGCCTGCCTCACGTGACGTCCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1165479508 19:36054329-36054351 CGTGGAGTCTCGTCACGTACCGG 0: 1
1: 0
2: 0
3: 0
4: 7
1165479503_1165479512 28 Left 1165479503 19:36054308-36054330 CCGCCTGCCTCACGTGACGTCCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1165479512 19:36054359-36054381 GCTGAGAGCGCCTGCCTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479503 Original CRISPR CGGACGTCACGTGAGGCAGG CGG (reversed) Exonic