ID: 1165479504

View in Genome Browser
Species Human (GRCh38)
Location 19:36054311-36054333
Sequence CCACGGACGTCACGTGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479504_1165479508 -5 Left 1165479504 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1165479508 19:36054329-36054351 CGTGGAGTCTCGTCACGTACCGG 0: 1
1: 0
2: 0
3: 0
4: 7
1165479504_1165479509 -4 Left 1165479504 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1165479509 19:36054330-36054352 GTGGAGTCTCGTCACGTACCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1165479504_1165479512 25 Left 1165479504 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1165479512 19:36054359-36054381 GCTGAGAGCGCCTGCCTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 87
1165479504_1165479510 -3 Left 1165479504 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1165479510 19:36054331-36054353 TGGAGTCTCGTCACGTACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479504 Original CRISPR CCACGGACGTCACGTGAGGC AGG (reversed) Exonic