ID: 1165479505

View in Genome Browser
Species Human (GRCh38)
Location 19:36054311-36054333
Sequence CCTGCCTCACGTGACGTCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479499_1165479505 -6 Left 1165479499 19:36054294-36054316 CCCACCCGCGCTCGCCGCCTGCC 0: 1
1: 0
2: 1
3: 32
4: 244
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479495_1165479505 0 Left 1165479495 19:36054288-36054310 CCCCGCCCCACCCGCGCTCGCCG 0: 1
1: 0
2: 5
3: 59
4: 522
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479494_1165479505 5 Left 1165479494 19:36054283-36054305 CCTAACCCCGCCCCACCCGCGCT 0: 1
1: 0
2: 7
3: 46
4: 468
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479501_1165479505 -10 Left 1165479501 19:36054298-36054320 CCCGCGCTCGCCGCCTGCCTCAC 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479500_1165479505 -7 Left 1165479500 19:36054295-36054317 CCACCCGCGCTCGCCGCCTGCCT 0: 1
1: 0
2: 1
3: 39
4: 362
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479493_1165479505 8 Left 1165479493 19:36054280-36054302 CCGCCTAACCCCGCCCCACCCGC 0: 1
1: 0
2: 5
3: 81
4: 927
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479498_1165479505 -5 Left 1165479498 19:36054293-36054315 CCCCACCCGCGCTCGCCGCCTGC 0: 1
1: 0
2: 4
3: 26
4: 337
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479497_1165479505 -2 Left 1165479497 19:36054290-36054312 CCGCCCCACCCGCGCTCGCCGCC 0: 1
1: 1
2: 9
3: 74
4: 839
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1165479496_1165479505 -1 Left 1165479496 19:36054289-36054311 CCCGCCCCACCCGCGCTCGCCGC 0: 1
1: 1
2: 7
3: 68
4: 586
Right 1165479505 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479505 Original CRISPR CCTGCCTCACGTGACGTCCG TGG Exonic