ID: 1165479506 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:36054315-36054337 |
| Sequence | GACTCCACGGACGTCACGTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 21 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 19} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1165479506_1165479509 | -8 | Left | 1165479506 | 19:36054315-36054337 | CCTCACGTGACGTCCGTGGAGTC | 0: 1 1: 0 2: 0 3: 1 4: 19 |
||
| Right | 1165479509 | 19:36054330-36054352 | GTGGAGTCTCGTCACGTACCGGG | 0: 1 1: 0 2: 0 3: 0 4: 15 |
||||
| 1165479506_1165479512 | 21 | Left | 1165479506 | 19:36054315-36054337 | CCTCACGTGACGTCCGTGGAGTC | 0: 1 1: 0 2: 0 3: 1 4: 19 |
||
| Right | 1165479512 | 19:36054359-36054381 | GCTGAGAGCGCCTGCCTACTAGG | 0: 1 1: 0 2: 0 3: 7 4: 87 |
||||
| 1165479506_1165479510 | -7 | Left | 1165479506 | 19:36054315-36054337 | CCTCACGTGACGTCCGTGGAGTC | 0: 1 1: 0 2: 0 3: 1 4: 19 |
||
| Right | 1165479510 | 19:36054331-36054353 | TGGAGTCTCGTCACGTACCGGGG | 0: 1 1: 0 2: 0 3: 1 4: 13 |
||||
| 1165479506_1165479508 | -9 | Left | 1165479506 | 19:36054315-36054337 | CCTCACGTGACGTCCGTGGAGTC | 0: 1 1: 0 2: 0 3: 1 4: 19 |
||
| Right | 1165479508 | 19:36054329-36054351 | CGTGGAGTCTCGTCACGTACCGG | 0: 1 1: 0 2: 0 3: 0 4: 7 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1165479506 | Original CRISPR | GACTCCACGGACGTCACGTG AGG (reversed) | Exonic | ||