ID: 1165479506

View in Genome Browser
Species Human (GRCh38)
Location 19:36054315-36054337
Sequence GACTCCACGGACGTCACGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479506_1165479510 -7 Left 1165479506 19:36054315-36054337 CCTCACGTGACGTCCGTGGAGTC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1165479510 19:36054331-36054353 TGGAGTCTCGTCACGTACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1165479506_1165479509 -8 Left 1165479506 19:36054315-36054337 CCTCACGTGACGTCCGTGGAGTC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1165479509 19:36054330-36054352 GTGGAGTCTCGTCACGTACCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1165479506_1165479508 -9 Left 1165479506 19:36054315-36054337 CCTCACGTGACGTCCGTGGAGTC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1165479508 19:36054329-36054351 CGTGGAGTCTCGTCACGTACCGG 0: 1
1: 0
2: 0
3: 0
4: 7
1165479506_1165479512 21 Left 1165479506 19:36054315-36054337 CCTCACGTGACGTCCGTGGAGTC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1165479512 19:36054359-36054381 GCTGAGAGCGCCTGCCTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479506 Original CRISPR GACTCCACGGACGTCACGTG AGG (reversed) Exonic