ID: 1165479512

View in Genome Browser
Species Human (GRCh38)
Location 19:36054359-36054381
Sequence GCTGAGAGCGCCTGCCTACT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479503_1165479512 28 Left 1165479503 19:36054308-36054330 CCGCCTGCCTCACGTGACGTCCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1165479512 19:36054359-36054381 GCTGAGAGCGCCTGCCTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 87
1165479507_1165479512 8 Left 1165479507 19:36054328-36054350 CCGTGGAGTCTCGTCACGTACCG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1165479512 19:36054359-36054381 GCTGAGAGCGCCTGCCTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 87
1165479506_1165479512 21 Left 1165479506 19:36054315-36054337 CCTCACGTGACGTCCGTGGAGTC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1165479512 19:36054359-36054381 GCTGAGAGCGCCTGCCTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 87
1165479504_1165479512 25 Left 1165479504 19:36054311-36054333 CCTGCCTCACGTGACGTCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1165479512 19:36054359-36054381 GCTGAGAGCGCCTGCCTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479512 Original CRISPR GCTGAGAGCGCCTGCCTACT AGG Exonic