ID: 1165479633

View in Genome Browser
Species Human (GRCh38)
Location 19:36054954-36054976
Sequence GCCATCGTCACGCCGGAGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165479633_1165479640 -8 Left 1165479633 19:36054954-36054976 CCCGCCTCCGGCGTGACGATGGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1165479640 19:36054969-36054991 ACGATGGCGGCCGTAGGGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1165479633_1165479647 18 Left 1165479633 19:36054954-36054976 CCCGCCTCCGGCGTGACGATGGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1165479647 19:36054995-36055017 CTATGCGCGGAACGATGCAGGGG 0: 1
1: 0
2: 0
3: 0
4: 23
1165479633_1165479641 -5 Left 1165479633 19:36054954-36054976 CCCGCCTCCGGCGTGACGATGGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1165479641 19:36054972-36054994 ATGGCGGCCGTAGGGTCCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 45
1165479633_1165479646 17 Left 1165479633 19:36054954-36054976 CCCGCCTCCGGCGTGACGATGGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1165479646 19:36054994-36055016 GCTATGCGCGGAACGATGCAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1165479633_1165479645 16 Left 1165479633 19:36054954-36054976 CCCGCCTCCGGCGTGACGATGGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1165479645 19:36054993-36055015 GGCTATGCGCGGAACGATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 20
1165479633_1165479643 5 Left 1165479633 19:36054954-36054976 CCCGCCTCCGGCGTGACGATGGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1165479643 19:36054982-36055004 TAGGGTCCGGAGGCTATGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165479633 Original CRISPR GCCATCGTCACGCCGGAGGC GGG (reversed) Exonic
900013612 1:135197-135219 GCCTTCGAGACGCAGGAGGCCGG + Intergenic
901469526 1:9446603-9446625 GCCATCTCCACTCAGGAGGCTGG + Intergenic
902415664 1:16237222-16237244 GCCATGGAGACGCCGGAGGTTGG + Intergenic
904629386 1:31829769-31829791 TCCGTCGTTACGCAGGAGGCTGG + Intergenic
919866516 1:201787061-201787083 GCCATCCTAACGCTGAAGGCAGG + Intronic
919927709 1:202200895-202200917 GCCATGGGCAGGCCGGCGGCTGG + Intronic
920816726 1:209341301-209341323 GCCACCACCACCCCGGAGGCTGG - Intergenic
924257856 1:242200141-242200163 GCCATAGTCATGCTGAAGGCCGG + Intronic
1063463458 10:6228814-6228836 GTCATAGTCACGCCCGGGGCTGG + Intronic
1070351056 10:75592504-75592526 GGCATCGGGACGGCGGAGGCGGG + Intronic
1075587417 10:123667770-123667792 GCCAGCGTGACGACGGAGGTGGG - Intronic
1102895414 12:116594639-116594661 GCCATAGTCACCCCAGAGCCAGG - Intergenic
1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG + Exonic
1121078717 14:91090445-91090467 GCCAAAGTCATGCAGGAGGCTGG - Intronic
1126066272 15:44828398-44828420 GCCATGGTCTTGCTGGAGGCTGG + Intergenic
1126093610 15:45072468-45072490 GCCATGGTCTTGCTGGAGGCTGG - Intronic
1132717672 16:1300263-1300285 GCCAGGGTCGCGCGGGAGGCCGG + Intergenic
1134439879 16:14293083-14293105 GCCACAGTCACTCCAGAGGCTGG - Intergenic
1142660565 17:1426275-1426297 GGCATCGTCACGACACAGGCTGG - Intronic
1142801749 17:2350666-2350688 TCCACCGGCACGCTGGAGGCTGG - Intronic
1143509367 17:7387048-7387070 GCCAGCGTCACTGCCGAGGCTGG - Exonic
1150217006 17:63476682-63476704 GGCCTTGTCACTCCGGAGGCGGG + Intergenic
1151791378 17:76307931-76307953 TCCATCGGCACGCCAGAGGTGGG - Intergenic
1152586893 17:81193221-81193243 GGCACCCTCAGGCCGGAGGCAGG - Intronic
1152748390 17:82051587-82051609 GACGTCGTCAGGCCGCAGGCTGG + Exonic
1152751383 17:82064010-82064032 GCCACTGTCACGACAGAGGCAGG + Intronic
1160520992 18:79507879-79507901 GCCACCGTCCCGCGGGAAGCTGG + Intronic
1165479633 19:36054954-36054976 GCCATCGTCACGCCGGAGGCGGG - Exonic
1167504287 19:49863009-49863031 GGCGCCGGCACGCCGGAGGCTGG - Intronic
1168104705 19:54159621-54159643 GGCCTCGTCACGCCGCACGCGGG + Exonic
933868624 2:86546251-86546273 GCACTCGGCAGGCCGGAGGCAGG + Intronic
1184550661 22:45202725-45202747 GCCAAGGTCACACCGCAGGCTGG - Intronic
958865828 3:99500569-99500591 GACACCCTCACGCAGGAGGCAGG - Intergenic
968921512 4:3524486-3524508 GCCATTGGCACGCCAGAGGGAGG - Intronic
968934940 4:3604976-3604998 GCCCTCGTCACTCCCTAGGCTGG + Intergenic
1000470664 5:161637097-161637119 GCCATTGACAAGCCAGAGGCAGG + Intronic
1002191292 5:177479125-177479147 GCCACCCTCACTCCGTAGGCCGG - Intergenic
1005746085 6:28838958-28838980 GCCTCCGTCCCGCCGGGGGCCGG + Intergenic
1019183596 6:170208224-170208246 GCCATCCTCACGCTGGAACCCGG - Intergenic
1025182816 7:56832240-56832262 GCCATTGTCACGCAGGAGCTGGG + Intergenic
1025689110 7:63744734-63744756 GCCATTGTCACGCAGGAGCTGGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1035337999 7:158142360-158142382 GCCAGCGTCAGTCCGGAGGCTGG - Intronic
1036945459 8:13090583-13090605 GGCATCTTCCCGCCGGAGGTGGG + Intronic
1037644822 8:20783680-20783702 GCCATGGTCACAGAGGAGGCAGG - Intergenic
1039824714 8:41163356-41163378 GCCTTGGTCATGCTGGAGGCTGG - Intergenic
1049663010 8:143828913-143828935 GCCGTGGTCACGACGGAAGCGGG - Intronic
1061213821 9:129208785-129208807 GCCATGGTTCCGCAGGAGGCTGG - Intergenic
1203770040 EBV:45243-45265 GCCATCACCAGACCGGAGGCTGG - Intergenic