ID: 1165480336

View in Genome Browser
Species Human (GRCh38)
Location 19:36059818-36059840
Sequence CAGCGTAAACACCTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165480336 Original CRISPR CAGCGTAAACACCTGGAGGA GGG Intronic
902319241 1:15648747-15648769 CAGAGTAAACACCTAGATGCAGG + Intronic
905313457 1:37066287-37066309 TTGAGTAAAGACCTGGAGGAAGG - Intergenic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
919469148 1:197957411-197957433 CTGAGTAAAGACCTGGAAGAGGG + Intergenic
920536958 1:206743783-206743805 CACCGCAAGGACCTGGAGGATGG - Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1065443354 10:25773715-25773737 GAGCGTAGAGACATGGAGGAGGG + Intergenic
1070298588 10:75186253-75186275 AAGACTAAACACCTGGAGAAGGG - Intergenic
1071128974 10:82369944-82369966 CAGCTGAAACCCCTGAAGGAGGG + Intronic
1074826558 10:117219113-117219135 CAGCGTAGGTACCTGGTGGATGG + Intergenic
1075959178 10:126552518-126552540 CAGCGAGAACGCCTGGATGATGG - Intronic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1079084995 11:17439030-17439052 GAGCATAAACTCCTGGAGAACGG + Intronic
1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG + Intronic
1095989981 12:48027829-48027851 CTGTGTAAACTCCTGGAGGCAGG + Intergenic
1097312790 12:58139495-58139517 TAGGGTATACACCTGGAGGAAGG - Intergenic
1098585234 12:72146586-72146608 CAGCTCAAACCCCTTGAGGAAGG + Intronic
1100583199 12:95955722-95955744 TAGCGTCACCAGCTGGAGGATGG + Intronic
1101960715 12:109247669-109247691 CACTGTAAACACATCGAGGAAGG + Exonic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1102901571 12:116642173-116642195 CACAGTAAAAACCTGGAGGGTGG - Intergenic
1105747360 13:23390861-23390883 CAGTGTAAACACCTGAATGAGGG - Intronic
1105759766 13:23503228-23503250 CAGCGTCAACCCCTGGGGCAAGG - Intergenic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1111880637 13:93952142-93952164 CACAGGAAACATCTGGAGGAAGG + Intronic
1113233653 13:108243323-108243345 CAAAGTAAACACTTGGAAGATGG + Intergenic
1114414249 14:22529338-22529360 GACCGTAGACACCAGGAGGACGG + Intergenic
1115026719 14:28755541-28755563 CAGCCTAAACACGTAGGGGAAGG + Intergenic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1120715783 14:87839435-87839457 AAGTGTAAATACTTGGAGGATGG - Intronic
1121451213 14:94009335-94009357 CAGCTCAGACACCTGCAGGATGG - Intergenic
1132043068 15:98541480-98541502 CAGATTAAAGATCTGGAGGATGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1144705287 17:17363910-17363932 CAGAGTGAGCACCTGCAGGATGG + Intergenic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150642802 17:66961017-66961039 CAGGTTTCACACCTGGAGGATGG - Intergenic
1150961795 17:69921506-69921528 CAGCTTCCACACCTGCAGGAAGG - Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1152508817 17:80771577-80771599 CAGGGTAAACACCTGGGGCTGGG - Intronic
1154035482 18:10797793-10797815 CAGCATGAACACCAGGAGGTGGG - Intronic
1155667951 18:28334393-28334415 GACTGTATACACCTGGAGGAAGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1156482782 18:37446526-37446548 CAGCTTCACCACCTGGAAGATGG + Intronic
1157514634 18:48302115-48302137 CAGCGTCAACTCCTGGAGAAGGG - Intronic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1160735890 19:662364-662386 GGCTGTAAACACCTGGAGGAAGG + Intronic
1161772884 19:6241003-6241025 CAACGTAAACACCTGTAAAATGG + Intronic
1164503670 19:28840512-28840534 CAGGGTTTACTCCTGGAGGAAGG + Intergenic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1165490905 19:36122074-36122096 CAGAGGAAGCACCTGGAGGCTGG + Intronic
1165967685 19:39597153-39597175 CTGAGTAAACACCTGGGGGCTGG + Intergenic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167602966 19:50465188-50465210 CACCGTGAACACCAGGCGGAGGG - Intronic
1167725701 19:51211482-51211504 CATCGTAGACGCCAGGAGGAGGG + Intergenic
1167727370 19:51225492-51225514 CATCGTAGACGCCAGGAGGAGGG + Exonic
1168039468 19:53746460-53746482 CAGCGGTAACACCAGGGGGAAGG - Intergenic
929790265 2:45017411-45017433 CAGCGTCATCACCTGTAAGATGG - Intergenic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
931685422 2:64788183-64788205 CAGTGCAAATTCCTGGAGGAGGG - Intergenic
932438069 2:71714804-71714826 GAGTGTAAACCCCAGGAGGAGGG + Intergenic
933076890 2:77940105-77940127 CAGCATGAATACCTGGAGGCAGG + Intergenic
933635795 2:84707958-84707980 CAGCTCAAAAACCTGGGGGAAGG + Intronic
935468454 2:103428370-103428392 CATTGAAATCACCTGGAGGAAGG + Intergenic
937259243 2:120574884-120574906 CAGAGCAGACACCTGGATGAAGG - Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939276949 2:140011279-140011301 AAGCATCAACACCTGCAGGATGG - Intergenic
939279392 2:140042705-140042727 CAGCGCAAATACCTTGAGGCAGG - Intergenic
942185341 2:173420182-173420204 CATGATAAACTCCTGGAGGAAGG - Intergenic
942326255 2:174779294-174779316 CATGGCACACACCTGGAGGAAGG - Intergenic
946568313 2:220992831-220992853 CATGTTAAACACCTGGTGGATGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948698383 2:239745560-239745582 GAGTGTGACCACCTGGAGGACGG - Intergenic
1168753499 20:299757-299779 CTGAGAAATCACCTGGAGGAGGG + Exonic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1173648637 20:44649500-44649522 CAGTGTCCACACCTGGAGGATGG - Intronic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1183086976 22:35492339-35492361 CAGAGAATACACCTGGAGCAGGG - Intergenic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1184975076 22:48055831-48055853 GAGCTTAATCCCCTGGAGGAGGG + Intergenic
950396140 3:12735559-12735581 CAGCCTAAACTTCTGGAAGAGGG + Exonic
951372037 3:21861234-21861256 CAGCCAAAACACCTGGACTATGG - Intronic
953060513 3:39424977-39424999 CAGAGTAAGTTCCTGGAGGATGG - Intergenic
954222599 3:49163695-49163717 CAGGGTAGACACCTGGATAAAGG + Exonic
959255477 3:104006393-104006415 CAGCACAAAGTCCTGGAGGAAGG + Intergenic
964533322 3:157691677-157691699 CAGAGTAAACTCCTAGATGAAGG + Intergenic
967169763 3:186813873-186813895 AAGTGTGAACACCTGGAGGTAGG + Intergenic
967967892 3:194976391-194976413 CAAAGGAAACACCTGGAAGAGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976886130 4:89986699-89986721 CAGTCTAAAGACCTGGAGGCAGG - Intergenic
983178069 4:164615036-164615058 CACTGTAAGCAACTGGAGGATGG - Intergenic
986750836 5:10786644-10786666 CAACCAAAACACCAGGAGGAAGG + Intergenic
986942807 5:12975903-12975925 CAGAGAAAACACCTGGAGTGAGG - Intergenic
989350065 5:40475954-40475976 CAGCATAAATACCATGAGGAGGG + Intergenic
989852412 5:46230707-46230729 CAGAGTAAAAAACTGGAGGACGG + Intergenic
992444481 5:76821295-76821317 CATCGTTAACTCCTGGAGGCAGG + Intronic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
997701095 5:135899941-135899963 AAGGGTAAAGGCCTGGAGGATGG - Intergenic
998106496 5:139472361-139472383 CAGAGTAAAGACCTGGAGAGAGG - Intergenic
999100196 5:149017464-149017486 CAGAGTAAAAACCTGAAGGCTGG + Intronic
1000127936 5:158265620-158265642 CAGCATTATCACCTGGAGGTGGG - Intergenic
1000297379 5:159923714-159923736 CATCAGAAACATCTGGAGGAGGG + Intronic
1001229396 5:169972971-169972993 CAGCAGAAACAACTAGAGGAGGG + Intronic
1002948021 6:1781243-1781265 CAGCAAGGACACCTGGAGGAAGG - Intronic
1003418706 6:5936757-5936779 CAGCGTCAAAACTTGCAGGATGG + Intergenic
1004443012 6:15671870-15671892 CAGCATAAACTCCTGGAAGGTGG + Intergenic
1007211164 6:40194405-40194427 CAGCAGAAACACCTGGGGAAGGG + Intergenic
1011514896 6:88143655-88143677 CACTGTAAACCCCTGGAGAATGG + Exonic
1012805479 6:103887366-103887388 GAGATTAAACACCTGAAGGAAGG + Intergenic
1015927823 6:138328010-138328032 CAGCATAAACACCTGTATGGGGG - Exonic
1022589865 7:31651303-31651325 CAGCCCACACACCTGGAGCAAGG + Intronic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1030184686 7:106750198-106750220 AAGCGTAAGCACCTGTGGGAAGG + Intergenic
1031223329 7:119001329-119001351 CCTCAGAAACACCTGGAGGAGGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033201451 7:139375446-139375468 GAGCGTACAAACCTGGAAGAAGG - Intronic
1034196724 7:149254089-149254111 CAGCGTTGCCACCTGCAGGAGGG + Exonic
1034893049 7:154857472-154857494 CATGGCAAACACCTGGAGGCTGG - Intronic
1036690118 8:10939929-10939951 CAGGGGACACACCTGGGGGAGGG - Intronic
1043189108 8:77194627-77194649 CAGAGTAAACACCTAGAGAATGG + Intergenic
1043412199 8:80009223-80009245 CAGCGAAAACACCTGGACACAGG + Intronic
1043740686 8:83807884-83807906 CAGCCTACACACTGGGAGGATGG - Intergenic
1047480104 8:125273953-125273975 CAGAGGAGGCACCTGGAGGAGGG - Intronic
1047539773 8:125753503-125753525 AAGAGCAAACACCTGAAGGAAGG + Intergenic
1048617135 8:136089112-136089134 CAGAGTAAACTCCTGCAGGGAGG - Intergenic
1057806481 9:98223309-98223331 CCCAGTAAAGACCTGGAGGAAGG + Intronic
1059951157 9:119463645-119463667 CAGCTGAAACCCCTTGAGGATGG - Intergenic
1062522445 9:136963919-136963941 CAGCGGAAGCCCCTGGATGAGGG + Intergenic
1186516181 X:10167455-10167477 GAGCATGAACACCTGGAGGTAGG - Intronic
1187569753 X:20488945-20488967 AAGCCTTAGCACCTGGAGGATGG + Intergenic
1189293343 X:39901375-39901397 CAGCCTCAAGACCTGGAGGATGG + Intergenic
1190744738 X:53315797-53315819 CAGAGTAAAGGCCTGGAGCATGG - Intronic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1197583488 X:128313675-128313697 CAGTGTTAACACCTGCTGGAAGG - Intergenic
1199053649 X:143266603-143266625 AAGCTTAAAAACCTGGTGGAAGG - Intergenic
1199095192 X:143730080-143730102 AGGCGTAAACTCCAGGAGGAAGG - Intergenic
1201560991 Y:15316460-15316482 CAGAGAAAACACCTGGACGCAGG - Intergenic
1202259392 Y:22954291-22954313 CAGCAAAAACACCTACAGGATGG - Intergenic
1202412378 Y:24588035-24588057 CAGCAAAAACACCTACAGGATGG - Intergenic
1202458402 Y:25082035-25082057 CAGCAAAAACACCTACAGGATGG + Intergenic