ID: 1165487863

View in Genome Browser
Species Human (GRCh38)
Location 19:36106172-36106194
Sequence AGCAGGCATCTGGCCACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165487852_1165487863 5 Left 1165487852 19:36106144-36106166 CCCAGCACTGCTACCAGCTCCCC No data
Right 1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG No data
1165487853_1165487863 4 Left 1165487853 19:36106145-36106167 CCAGCACTGCTACCAGCTCCCCC No data
Right 1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG No data
1165487855_1165487863 -8 Left 1165487855 19:36106157-36106179 CCAGCTCCCCCAGACAGCAGGCA No data
Right 1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG No data
1165487851_1165487863 14 Left 1165487851 19:36106135-36106157 CCACGAGCTCCCAGCACTGCTAC No data
Right 1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165487863 Original CRISPR AGCAGGCATCTGGCCACATG GGG Intergenic
No off target data available for this crispr