ID: 1165495262

View in Genome Browser
Species Human (GRCh38)
Location 19:36149012-36149034
Sequence CCTAACAGGCTACTAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165495262_1165495276 29 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495276 19:36149064-36149086 GTCAGTAGGAGGCTGGGGCTGGG 0: 1
1: 0
2: 2
3: 41
4: 469
1165495262_1165495274 24 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495274 19:36149059-36149081 TAGATGTCAGTAGGAGGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 207
1165495262_1165495271 18 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495271 19:36149053-36149075 GGAGCATAGATGTCAGTAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1165495262_1165495269 -3 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495269 19:36149032-36149054 AGGCTTAGAACTGGAGAGGATGG 0: 1
1: 1
2: 3
3: 36
4: 388
1165495262_1165495270 15 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495270 19:36149050-36149072 GATGGAGCATAGATGTCAGTAGG 0: 1
1: 0
2: 0
3: 17
4: 141
1165495262_1165495275 28 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495275 19:36149063-36149085 TGTCAGTAGGAGGCTGGGGCTGG 0: 1
1: 0
2: 3
3: 58
4: 681
1165495262_1165495268 -7 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1165495262_1165495272 22 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495272 19:36149057-36149079 CATAGATGTCAGTAGGAGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165495262_1165495273 23 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495273 19:36149058-36149080 ATAGATGTCAGTAGGAGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165495262 Original CRISPR CCTAACAGGCTACTAGAGGG AGG (reversed) Intronic
903701983 1:25255959-25255981 CCTAACAGGCCACAAATGGGGGG + Intronic
906020980 1:42629347-42629369 CCTTACAGGCCACGAGAGAGTGG - Intronic
908325409 1:63018765-63018787 CTTGAATGGCTACTAGAGGGGGG - Intergenic
911853193 1:102844065-102844087 CCTAACAGGCCACGAAAGAGTGG + Intergenic
911897641 1:103457937-103457959 ACTAACAGGCTTCTTGTGGGTGG + Intergenic
916616203 1:166443515-166443537 CCTAACAGGCCAGGAGAGAGTGG - Intergenic
919915316 1:202135304-202135326 CCTAAGAGGCTACAAAGGGGAGG + Intronic
921769937 1:219023968-219023990 CCTAACAGGCCAGGAGAGAGAGG + Intergenic
921874832 1:220183150-220183172 CCAAACATGGTACTAGAGGTAGG + Intronic
923052577 1:230399043-230399065 CCTCACAGGTTACTAAGGGGGGG + Intronic
1063232314 10:4077228-4077250 CCAAACAGGCTGGGAGAGGGTGG + Intergenic
1064713863 10:18154960-18154982 CATAACAGATTACTACAGGGTGG - Intronic
1065467572 10:26042140-26042162 CCTTACAGGCCAGTAGAGAGTGG - Intronic
1068350013 10:55830926-55830948 CCTCACATGTTACCAGAGGGAGG + Intergenic
1068859556 10:61833516-61833538 CTTTACAGTCTAGTAGAGGGTGG - Intergenic
1070059208 10:72966361-72966383 CCTTACAGGCCAGGAGAGGGTGG - Intergenic
1080831540 11:35897711-35897733 CCTAAAAGGCCAATAGAAGGGGG + Intergenic
1082087695 11:48063561-48063583 CCCAACAGGCTGCTGGGGGGTGG + Intronic
1087532686 11:99405042-99405064 CCTTACAGGCTAGGAGAGAGTGG - Intronic
1087757602 11:102071783-102071805 CCTTACAGGCCAGTAGAGGATGG - Intronic
1090859569 11:130640779-130640801 GCTAAGAGGCTACTAGACAGTGG - Intergenic
1091025290 11:132136079-132136101 CCTCACAGTCCACTAGAGAGAGG + Intronic
1092959193 12:13579862-13579884 CCTGAAAGGCTTCTAGAAGGAGG + Intronic
1097340117 12:58427675-58427697 CCTAACAAGCTAGAAGAGAGTGG + Intergenic
1116954237 14:50907541-50907563 TCAAACAGGCTCCTTGAGGGAGG + Intronic
1119940748 14:78638666-78638688 CCTAAGAGGCTCTTAGAGGTAGG + Intronic
1123072419 14:105648212-105648234 CTGAACAGGCTACAAGAGGCTGG - Intergenic
1123954534 15:25321275-25321297 CCTTACAGGCCAGTAGAGAGTGG - Intergenic
1131409857 15:92198598-92198620 AATACCAGACTACTAGAGGGAGG - Intergenic
1131453904 15:92568211-92568233 AATACCAGACTACTAGAGGGAGG + Intergenic
1132318849 15:100910305-100910327 GCAAACAGGCCACTAGAGGGAGG - Intronic
1138399507 16:56734075-56734097 CCTAACAGGCTCCTTGAGTCTGG - Intronic
1138864842 16:60804501-60804523 CCTTACAGGCCACGAGAGAGTGG + Intergenic
1143991794 17:10970346-10970368 CACTACAGGCTACTAGAGTGGGG + Intergenic
1146280264 17:31540118-31540140 CCTTTCAGGGTACTAGAGAGGGG + Intergenic
1151874541 17:76859489-76859511 GCTTACAGGCTCCTGGAGGGTGG + Intergenic
1157520757 18:48343707-48343729 CCCAACAGGCTATTAGGGGAAGG - Intronic
1162666571 19:12218575-12218597 CCTTACAGGCCACCAGAGAGTGG - Intergenic
1163862686 19:19750392-19750414 CCTTTCAGGCTGCCAGAGGGAGG + Intergenic
1165495262 19:36149012-36149034 CCTAACAGGCTACTAGAGGGAGG - Intronic
930565590 2:53015363-53015385 ACTAACAGGTTACCAGAGTGGGG - Intergenic
932301084 2:70667375-70667397 ACTAAAAGGCTGCTAGAGGCTGG + Intronic
933180337 2:79219572-79219594 TCTAACAGGCCACAAGATGGCGG - Intronic
936825212 2:116574258-116574280 CCTTACAGGCCAAGAGAGGGTGG - Intergenic
937043796 2:118840212-118840234 CCTAAGAGGCCACAATAGGGAGG + Intergenic
937153666 2:119703114-119703136 CCTAGCAGGCTAGTAAAGCGAGG - Intergenic
937793807 2:125993293-125993315 CCTTACAGGCTAGTAGAGAGGGG - Intergenic
938213205 2:129485765-129485787 CCTAAGAGGTTAATAGATGGAGG + Intergenic
940291164 2:152078824-152078846 CTTAACAGTCTACAAGAAGGTGG - Intronic
940433248 2:153619765-153619787 CCTTACAGGCCAGGAGAGGGTGG - Intergenic
940559636 2:155279510-155279532 CCTTACAGGCCAGGAGAGGGTGG - Intergenic
940786167 2:157983575-157983597 CCTTACAGGCTAGAAGAGAGTGG - Intronic
948324809 2:237106175-237106197 AGTAACAGGATACTAGAGGCTGG + Intergenic
948685939 2:239669835-239669857 CCCCACAGGGCACTAGAGGGAGG - Intergenic
1170053003 20:12167331-12167353 CCTTAGAGTCTACTTGAGGGTGG - Intergenic
1176387697 21:6147193-6147215 CCTCACAGGCTATTGGCGGGAGG - Intergenic
1177486823 21:21768987-21769009 CCCTACAGACTACTAGAGGGAGG + Intergenic
1179735775 21:43391055-43391077 CCTCACAGGCTATTGGCGGGAGG + Intergenic
1182062594 22:27408421-27408443 CCTAACAGGGTACTTCATGGAGG - Intergenic
1184491150 22:44809875-44809897 CCCAAAAGGCAACTGGAGGGAGG - Intronic
954947917 3:54442942-54442964 CCCAAGAGGCTACTATATGGTGG - Intronic
961031808 3:123612009-123612031 CCTAACAGGCTACTTACCGGGGG + Intronic
962998546 3:140654778-140654800 ACTTACAGGCTAGTAGAGAGTGG + Intergenic
966289447 3:178338274-178338296 CATTACAGACTACTAGAGGATGG - Intergenic
970303414 4:14705277-14705299 CCTAAAAGGACACTAAAGGGTGG - Intergenic
972237272 4:37149190-37149212 CCTTACAGGCTAGGAGAGAGTGG - Intergenic
975675055 4:76819508-76819530 CCTTGCAGGCTAGGAGAGGGTGG - Intergenic
978367188 4:107994811-107994833 ACTAATATGCTAATAGAGGGTGG - Intronic
979213094 4:118130891-118130913 CCTGACAGGCCAGGAGAGGGTGG - Intronic
983921460 4:173350077-173350099 AATAACAAGCTACTGGAGGGGGG + Intergenic
990848602 5:60174816-60174838 CCTTAAAGGCAACCAGAGGGAGG - Intronic
993271165 5:85797851-85797873 CCTAAAAGGATATTAGAGAGAGG - Intergenic
994845553 5:104984992-104985014 CCTTACAGGCTAGGAGAGAGTGG - Intergenic
995098395 5:108268245-108268267 CCTAAGAGGCAACAAGAGGTAGG + Intronic
997200096 5:132004745-132004767 CCTACCAGCCTACTGGATGGGGG + Intronic
1007239138 6:40412549-40412571 CCTAACAGGCTATGAGACTGGGG + Intronic
1012047998 6:94302852-94302874 CCCTGCAGACTACTAGAGGGAGG + Intergenic
1012272643 6:97233480-97233502 GCTTATAGGCTACTAGTGGGTGG - Intronic
1012486059 6:99723549-99723571 CCTAACAGGCCAGGAGAGAGTGG - Intergenic
1016061353 6:139634543-139634565 CCTTACAGGCTAGGAGAGAGTGG - Intergenic
1022272858 7:28827072-28827094 TCTAACTGGCAACCAGAGGGAGG + Intergenic
1022816592 7:33920164-33920186 CCAAATTGGCTACTTGAGGGAGG - Intronic
1022875741 7:34527448-34527470 CCTTACAGGCTAGGAGAGAGTGG - Intergenic
1036213095 8:6858299-6858321 CCTTACTGGCCACTAGAAGGCGG + Intergenic
1039002147 8:32993772-32993794 CCTTACAGGCCACGAGAGAGTGG - Intergenic
1040061306 8:43105351-43105373 CCTAACAGTTTTCTAGAGGCTGG - Intronic
1041869082 8:62613342-62613364 CCTTACAGGCTAGTAGAGAGTGG - Intronic
1043260268 8:78186552-78186574 CCCAACAGGCCCCTAGAGGTGGG - Intergenic
1045112555 8:98948469-98948491 CCTAACAGGCTTGGGGAGGGTGG + Intronic
1046064761 8:109183116-109183138 CCTAACCAGCTACCAGAGTGGGG - Intergenic
1051704529 9:19862262-19862284 CCTTACAGGCTAGGAGAGAGTGG + Intergenic
1051990895 9:23151817-23151839 CCTTACAGGCTAGGAGAGAGTGG - Intergenic
1052624931 9:30962599-30962621 CCTCACTGGCTTCTAGAGGAGGG - Intergenic
1059526042 9:114991926-114991948 TCTTACAGTCTACTAGATGGGGG - Intergenic
1061723744 9:132570027-132570049 CCTAAAAGGCAGCTAGAGGCTGG - Intronic
1187170177 X:16843467-16843489 CCTAAGAGGCTGTTGGAGGGTGG - Exonic
1188413009 X:29897052-29897074 CCTTAGAGGCTACTAGAGTAGGG + Intronic
1192067263 X:67899072-67899094 CCTTACAGGCCAGTAGAGAGTGG + Intergenic
1194058244 X:89164005-89164027 CCTAGCAGGCTCCTGGGGGGAGG - Intergenic
1194315096 X:92367825-92367847 CCTTACAAGCTAGAAGAGGGTGG - Intronic
1194396340 X:93391897-93391919 CCTTACAGGCTATGAGAGAGTGG - Intergenic
1194546557 X:95241594-95241616 CCTTACAGGCCACAAGAGAGTGG + Intergenic
1195116074 X:101698951-101698973 CTTAACAGGCTAGGAGAGAGTGG + Intergenic
1195172055 X:102279479-102279501 CCTTACAGGCCAGGAGAGGGTGG - Intergenic
1195186805 X:102407614-102407636 CCTTACAGGCCAGGAGAGGGTGG + Intronic
1198127414 X:133659617-133659639 CCTCACAGCCTCCTTGAGGGAGG - Intronic
1198982145 X:142410168-142410190 CCTTACAGGCCAGTAGAGAGTGG + Intergenic
1199162540 X:144630077-144630099 CCTTACAGGCTAAGAGAGAGTGG + Intergenic