ID: 1165495264

View in Genome Browser
Species Human (GRCh38)
Location 19:36149015-36149037
Sequence AAGCCTAACAGGCTACTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165495264_1165495275 25 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495275 19:36149063-36149085 TGTCAGTAGGAGGCTGGGGCTGG 0: 1
1: 0
2: 3
3: 58
4: 681
1165495264_1165495273 20 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495273 19:36149058-36149080 ATAGATGTCAGTAGGAGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 152
1165495264_1165495270 12 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495270 19:36149050-36149072 GATGGAGCATAGATGTCAGTAGG 0: 1
1: 0
2: 0
3: 17
4: 141
1165495264_1165495272 19 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495272 19:36149057-36149079 CATAGATGTCAGTAGGAGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165495264_1165495269 -6 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495269 19:36149032-36149054 AGGCTTAGAACTGGAGAGGATGG 0: 1
1: 1
2: 3
3: 36
4: 388
1165495264_1165495271 15 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495271 19:36149053-36149075 GGAGCATAGATGTCAGTAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1165495264_1165495274 21 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495274 19:36149059-36149081 TAGATGTCAGTAGGAGGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 207
1165495264_1165495268 -10 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1165495264_1165495276 26 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495276 19:36149064-36149086 GTCAGTAGGAGGCTGGGGCTGGG 0: 1
1: 0
2: 2
3: 41
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165495264 Original CRISPR AAGCCTAACAGGCTACTAGA GGG (reversed) Intronic
900960599 1:5916848-5916870 AAGCACAGCAGGCTTCTAGAAGG + Intronic
905147506 1:35899197-35899219 AATCCTAACATGCTACAACACGG - Intronic
907338545 1:53716761-53716783 AAGCCAAACAGGCAACTAGGGGG + Intronic
908718865 1:67101085-67101107 ATGGCTCACAGGCTACTTGATGG + Intronic
912871150 1:113308036-113308058 AACCCGAACAGGCTACTATGTGG - Intergenic
916909180 1:169326513-169326535 AAGCCTAAGAAGCTGGTAGAGGG + Intronic
917656081 1:177127039-177127061 AAGCATAAAAGGCTTTTAGAGGG + Intronic
920764076 1:208814279-208814301 ATTACTAACAGGCTAATAGAAGG + Intergenic
1064891312 10:20177277-20177299 AAGACTAACAGGCAACTTGGAGG - Intronic
1072762732 10:98070840-98070862 AAGGCTAAAATGCTACTAGTTGG - Intergenic
1076696887 10:132251359-132251381 AAGCCGGACAGGCTCCCAGAAGG + Intronic
1079106256 11:17574235-17574257 GAGCAAAACAGGCTGCTAGAGGG + Intronic
1079315684 11:19406182-19406204 AAGCTTAGCAGGCTACCAGGTGG - Intronic
1080160870 11:29174498-29174520 AAGTCTTTCAGGCTACCAGAAGG + Intergenic
1090051969 11:123387736-123387758 AGGCCAAACAGGCTACTTGTGGG - Intergenic
1090568851 11:128025533-128025555 AAGGCAGACAGGATACTAGAGGG + Intergenic
1091058990 11:132444286-132444308 AACCCTCACAGGTTTCTAGAGGG - Intronic
1098516464 12:71382327-71382349 AAGGCTAACATGCAACTAGCAGG + Intronic
1103596720 12:122028741-122028763 ATTCCCAACAGGCTACAAGAGGG - Intronic
1107981390 13:45737454-45737476 AAGTCCAACTGGCTACTAGGAGG - Intergenic
1108400237 13:50034343-50034365 TAGCCTTACAGGCTAATAGCAGG + Intergenic
1110903677 13:80857945-80857967 TAGCCTGATAGGCTTCTAGAAGG + Intergenic
1112102348 13:96203090-96203112 AAGCCCAACATGCTTCTATATGG - Intronic
1117480464 14:56139007-56139029 CAGCCTGACAGGGTACTGGAGGG + Intronic
1118588045 14:67375055-67375077 AATCCTAACACGCTAGTGGAGGG - Intronic
1119164229 14:72479158-72479180 AAGGCTTACAGGCTTATAGATGG - Intronic
1126062729 15:44799504-44799526 GAGCCTAACAGGAAACCAGATGG - Intergenic
1132318850 15:100910308-100910330 AATGCAAACAGGCCACTAGAGGG - Intronic
1138262556 16:55635648-55635670 AAGCCTACCAAACTACTAAATGG - Intergenic
1147287357 17:39412854-39412876 AAGCCTAACGGATTACTATATGG - Intronic
1157244328 18:46040179-46040201 AAGCCTGACAGGCTCCTAAGTGG - Intronic
1159211208 18:65325058-65325080 AAGCCTACCAAGCTATTTGAGGG - Intergenic
1163198949 19:15748325-15748347 AAGACCAACAGGCAAGTAGAGGG - Intergenic
1165495264 19:36149015-36149037 AAGCCTAACAGGCTACTAGAGGG - Intronic
928455340 2:31415862-31415884 AACCCTAGCAGGCTACCTGAGGG + Intergenic
929230230 2:39551875-39551897 AAGCATAACTGCATACTAGATGG + Intergenic
930171386 2:48255245-48255267 AATCCTGACAAGGTACTAGAGGG + Intergenic
930306236 2:49678019-49678041 ACGCCTAACAGGAAGCTAGATGG - Intergenic
938023502 2:127925215-127925237 AAGCCTAACAGGGAATTATATGG + Intergenic
938742439 2:134245559-134245581 AGGCAAAACAGGCCACTAGAGGG - Intronic
939608866 2:144285886-144285908 GAGAGTAACAAGCTACTAGAAGG - Intronic
940790430 2:158025456-158025478 AAGCCAAACAGGCTAAGAGCAGG + Intronic
942336835 2:174897620-174897642 TAGCTTAACTAGCTACTAGACGG - Intronic
1171302374 20:24074888-24074910 AAGCCTAACAAGATAAAAGAGGG + Intergenic
1174508126 20:51030320-51030342 AAGCCTGACAGACTCCTAGCAGG - Intergenic
1180907156 22:19422518-19422540 GAGCCTAGTAGGCTACTAGAAGG - Intronic
949466600 3:4350972-4350994 AACCCAAACTGGCCACTAGAGGG + Intronic
952525230 3:34203091-34203113 GAGCCTAACAGGAAACCAGATGG + Intergenic
953591219 3:44256716-44256738 AAGCCTACCATGGTATTAGAAGG - Intronic
957028148 3:75208783-75208805 AAGCCTGACATGCTAGCAGAAGG + Intergenic
958268441 3:91467965-91467987 AAGCATAACAGGAAACAAGAAGG + Intergenic
967103083 3:186233014-186233036 AAGCCTATGAGGCTAGTAGGTGG + Intronic
970998067 4:22290863-22290885 AATTAGAACAGGCTACTAGAAGG + Intergenic
972262754 4:37427062-37427084 AGACCTAATTGGCTACTAGATGG + Intronic
973901983 4:55484818-55484840 AAGCCTTGCTGACTACTAGAAGG + Intronic
979213096 4:118130894-118130916 AAGCCTGACAGGCCAGGAGAGGG - Intronic
981839694 4:149096775-149096797 AATGCAAACAGGCTACAAGATGG - Intergenic
991478386 5:67048841-67048863 AAGCCCAACAAGCCACTAAAAGG + Intronic
999177025 5:149638923-149638945 AAACCTACCAGGCAACCAGAGGG - Intergenic
1008986766 6:57553621-57553643 AAGCATAACAGGAAACAAGAAGG - Intronic
1009174725 6:60446183-60446205 AAGCATAACAGGAAACAAGAAGG - Intergenic
1010036587 6:71332103-71332125 AAGGCTAATAGGATGCTAGAAGG + Intergenic
1012937507 6:105383632-105383654 AGGCCTGACAGGCTTCTAGAAGG - Intronic
1036783771 8:11671614-11671636 AAGCCTAACAGGCTGGAACAGGG + Intergenic
1038112527 8:24515231-24515253 AAGCAAAACAGGCTTCTAAATGG + Intronic
1038772715 8:30498039-30498061 AAGTCTTTCAGCCTACTAGATGG + Intronic
1043650836 8:82589516-82589538 AAGGCTGTCATGCTACTAGAAGG - Intergenic
1046373085 8:113336900-113336922 AGGCTTACCAGGCTACAAGAAGG - Intronic
1047723246 8:127661896-127661918 AATCCTACCAGGTTCCTAGAAGG - Intergenic
1060113219 9:120921173-120921195 CACCCTAACAGGCTACAGGATGG - Intronic
1061798038 9:133099848-133099870 AAGCAGAACAGGCTACTAGGAGG - Intronic
1186878789 X:13843554-13843576 AACCCTCACATGCTACTAGTGGG - Intronic
1192368119 X:70491983-70492005 CAGCCTCACAGTATACTAGAAGG - Intronic
1194058246 X:89164008-89164030 AAGCCTAGCAGGCTCCTGGGGGG - Intergenic
1194682558 X:96871559-96871581 AGAGGTAACAGGCTACTAGAAGG + Intronic
1195403698 X:104489741-104489763 AAACATAACAGGAAACTAGAAGG + Intergenic