ID: 1165495268

View in Genome Browser
Species Human (GRCh38)
Location 19:36149028-36149050
Sequence TGTTAGGCTTAGAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165495264_1165495268 -10 Left 1165495264 19:36149015-36149037 CCCTCTAGTAGCCTGTTAGGCTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1165495262_1165495268 -7 Left 1165495262 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165495268 Original CRISPR TGTTAGGCTTAGAACTGGAG AGG Intronic
911830526 1:102545370-102545392 TCATAGGCTTACAGCTGGAGAGG - Intergenic
915304510 1:154969973-154969995 AGTGAGCATTAGAACTGGAGGGG + Intronic
915713318 1:157921879-157921901 TGTTAGGCCTAGAATAGGAATGG + Intergenic
921736407 1:218633535-218633557 GGTCAGGGTTAGACCTGGAGAGG + Intergenic
924275488 1:242382003-242382025 TCTTGGAGTTAGAACTGGAGAGG + Intronic
1066721041 10:38339330-38339352 TGTAAGGCTTAAAAATGGACTGG - Intergenic
1067187176 10:44040506-44040528 TGTGGGGCATAAAACTGGAGAGG + Intergenic
1071048970 10:81422453-81422475 AGTCAGGCTTAGAACTTCAGTGG - Intergenic
1071105388 10:82087828-82087850 TAATAGGCTGAGACCTGGAGTGG - Intronic
1071117707 10:82242592-82242614 TGTTTTGCTGAGACCTGGAGAGG + Intronic
1071544561 10:86519612-86519634 TGTTAGTGTTAGAGCTGCAGTGG - Intronic
1080820681 11:35803315-35803337 ACTTAGACTTACAACTGGAGTGG - Intronic
1084352495 11:68612516-68612538 TGTTAGGCTCAAAACTGGGAGGG - Intronic
1084451607 11:69242385-69242407 GGTGAGGCTGGGAACTGGAGTGG - Intergenic
1084602347 11:70153510-70153532 TGCTCGGCATAGAACAGGAGGGG - Intronic
1086771681 11:90774898-90774920 TGTCAGGGTTAGACCTGAAGAGG + Intergenic
1089619128 11:119712503-119712525 TGCAAGGCTTAGGACGGGAGAGG + Intronic
1090717896 11:129446428-129446450 TGTTAGGCCTTTTACTGGAGAGG - Intronic
1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG + Intergenic
1093029764 12:14277455-14277477 TACTAGGCTTAGAAGTTGAGTGG - Intergenic
1095688999 12:45066731-45066753 GCTTATGCTTAGACCTGGAGAGG + Intergenic
1097557087 12:61151973-61151995 TGTTATGCTTCAAACTGGATTGG + Intergenic
1098753169 12:74321860-74321882 TTATAGGCTCAGAACTGGGGAGG + Intergenic
1100435629 12:94569043-94569065 TGCTAGGCTGAGCACTGGAATGG + Exonic
1101538067 12:105638798-105638820 TGTTAGGGTTACAGCTAGAGTGG - Intergenic
1103538615 12:121650978-121651000 TGTTAGGCTGAGAAGTGGTCAGG + Intergenic
1105768148 13:23580642-23580664 TGAAAGGTATAGAACTGGAGGGG + Intronic
1107618549 13:42199172-42199194 TGTTAAGTGTAGAAATGGAGGGG + Intronic
1108398935 13:50019492-50019514 TGATAAGATTAGATCTGGAGGGG + Intronic
1109689770 13:65870625-65870647 TGAAAGGCTTAGAGCAGGAGTGG - Intergenic
1114849348 14:26364611-26364633 TGTTAGGGTGACAACTGCAGAGG - Intergenic
1121967404 14:98323441-98323463 GGTTTGGATTAGAATTGGAGAGG - Intergenic
1124121722 15:26894007-26894029 TGTTAGGTCGAGGACTGGAGAGG + Intronic
1124932039 15:34129971-34129993 TATTAGGCTCAGCAGTGGAGGGG - Intergenic
1125682017 15:41536907-41536929 TGTGAGGCTGAGAAGTAGAGAGG - Intronic
1129171734 15:73812170-73812192 TGTCAGGCTTAGAGCTTCAGGGG - Intergenic
1132746304 16:1437746-1437768 TGGTGGGCTGAGAGCTGGAGGGG + Intronic
1138979452 16:62249428-62249450 TGTGAGGATTACAATTGGAGGGG + Intergenic
1143066701 17:4255108-4255130 AGTGTGGGTTAGAACTGGAGTGG - Intronic
1144362407 17:14507879-14507901 TGCAAGGCATAGATCTGGAGGGG + Intergenic
1146089624 17:29863329-29863351 TGTTAGCCTGAGTACTGGACTGG - Intronic
1148918508 17:51005894-51005916 TGACAGGCTAACAACTGGAGGGG + Intronic
1149290382 17:55212808-55212830 TATCAGGATTAAAACTGGAGAGG + Intergenic
1149553361 17:57556056-57556078 TGATAAGCTTGGAACTGGATTGG + Intronic
1151549796 17:74815660-74815682 CTGTAGGGTTAGAACTGGAGAGG + Intronic
1153331795 18:3881347-3881369 TGTTAAAGATAGAACTGGAGAGG + Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1166824604 19:45601153-45601175 TGTTTGGCGCAGAAGTGGAGAGG - Intronic
930709939 2:54541241-54541263 TTTTATGCCTAGAACTGCAGAGG + Intronic
932232581 2:70094856-70094878 TGTTAGGCCTTGCACTGGTGAGG - Intergenic
933277272 2:80297228-80297250 TGTTAGGTGTAGGAGTGGAGGGG + Intronic
935828753 2:106977290-106977312 TGTTAGTCTTAGATCTTGGGAGG + Intergenic
936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG + Intergenic
943463262 2:188196036-188196058 GGTTAGGCTTGGAATTAGAGAGG + Intergenic
945813261 2:214573567-214573589 TGTTTGGCCTAGAACTGGCTGGG + Intronic
948385662 2:237579092-237579114 TGTTATACACAGAACTGGAGAGG + Intronic
1170926504 20:20729496-20729518 TGTAAGGCTTAGAATTGAACTGG + Intergenic
1175167096 20:57052057-57052079 ATTTAGGTTTAGAAATGGAGAGG + Intergenic
1180849090 22:19003408-19003430 TGCTAGACTTAGAAATGGATTGG + Intergenic
1182955956 22:34426650-34426672 TGTTAGGCTTAGTACCTGGGTGG + Intergenic
949907167 3:8867396-8867418 TGTTAGGCTTGGGAGGGGAGAGG - Intronic
950871855 3:16236251-16236273 TGTTAGACTATGAACTAGAGTGG + Intergenic
951933723 3:27998658-27998680 TGATAGGCCTAGGACTGGAAGGG + Intergenic
953157319 3:40386946-40386968 TGTTTGGCTTCGACCTGGAGGGG + Intergenic
956059594 3:65336080-65336102 TGGGAGGTTTGGAACTGGAGTGG + Intergenic
957026623 3:75189703-75189725 TGTTAGTCTTGGAGGTGGAGTGG - Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958546085 3:95552446-95552468 TGTCAGGCTTGGTACTGGAATGG + Intergenic
960467339 3:118013588-118013610 TGTTGGTCTAAGAAGTGGAGTGG - Intergenic
961212068 3:125133127-125133149 TGTTTGGCTTTGAAGAGGAGAGG + Intronic
963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG + Intergenic
963597752 3:147349295-147349317 TGTTAGGCTGAGAATTGGCCTGG - Intergenic
964887172 3:161497667-161497689 AGTTAGGATTAGAAATGGAATGG + Intronic
966660335 3:182407779-182407801 TGTTTGCCTTAGAAGTGGAGTGG + Intergenic
972331472 4:38068116-38068138 TGTTCTGCTTGGAACTGGAGGGG - Intronic
972339295 4:38137214-38137236 TGCTTACCTTAGAACTGGAGCGG + Exonic
972733891 4:41821155-41821177 AGTTAGGCTGAGATCTGGACTGG + Intergenic
978702659 4:111667669-111667691 GCTTAGGCTTAAAACTGGAATGG - Intergenic
982301865 4:153887314-153887336 TGTCAGACCCAGAACTGGAGTGG - Intergenic
984695308 4:182773499-182773521 TGTTACGTTTCCAACTGGAGTGG + Exonic
986514810 5:8550136-8550158 TGTGTGGCAGAGAACTGGAGTGG - Intergenic
988177160 5:27743169-27743191 TGTTAGGCATGGACTTGGAGAGG + Intergenic
988321793 5:29707484-29707506 AGTTAGGCTAAGAAGTGGAAGGG + Intergenic
989718410 5:44493538-44493560 GGTTAGGTTTAGAACTAGAATGG - Intergenic
990804091 5:59638421-59638443 TGTTAGGCATAGAACTGCTCAGG - Intronic
992170793 5:74099882-74099904 TGTTATGGTTAGAGCTGGGGTGG - Intergenic
993348586 5:86818258-86818280 TTTTAGGCTAACAACTGGAAAGG + Intergenic
995109915 5:108417853-108417875 TTATAGGCTCAGAACTGGGGAGG - Intergenic
998298969 5:141000005-141000027 TGTCAGGCTTAGCAATGGGGAGG - Intronic
999783499 5:154870123-154870145 TTTGAGGCCAAGAACTGGAGGGG - Intronic
1000130814 5:158296387-158296409 TGTATTGCTTATAACTGGAGTGG + Intergenic
1004700626 6:18076003-18076025 TGATTGGCTTAGTTCTGGAGGGG + Intergenic
1005925453 6:30441247-30441269 TGCTAGGCTTAGAGCTCGGGAGG - Intergenic
1008632447 6:53375615-53375637 TGTAATGCTTAGAACAGGATAGG + Intergenic
1013787779 6:113801036-113801058 AGTTAGGCTTAGACCTTGACTGG + Intergenic
1014311290 6:119805385-119805407 TGTTAGGCCCAGAAATGGATGGG - Intergenic
1015219212 6:130784914-130784936 TGTTGGTCTTGGAACTAGAGGGG + Intergenic
1016459718 6:144269729-144269751 TTTTATGGTTAGAATTGGAGAGG - Intergenic
1017040763 6:150307030-150307052 TGATAAGCTTGGAACTGGAAGGG - Intergenic
1023424883 7:40025201-40025223 TGATAGGCTTAAAAATGCAGTGG - Intronic
1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG + Intronic
1026666880 7:72348437-72348459 TGTGGGGCAGAGAACTGGAGAGG + Intronic
1031580731 7:123471634-123471656 TGTTAGGCTAAAAACTTGGGGGG - Intronic
1032902226 7:136322236-136322258 AGTTAGGCTTAGAAATGGCCGGG - Intergenic
1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG + Intronic
1034407287 7:150913533-150913555 TGTGAGGCTTGGAAGTGCAGCGG - Intergenic
1034626209 7:152494770-152494792 TATAAGGCAGAGAACTGGAGAGG + Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1038567349 8:28630752-28630774 TGAGAGGCTTATAACTGGGGCGG + Intronic
1038851146 8:31277523-31277545 TAAGAGGCTTAGAACTGTAGGGG - Intergenic
1039618761 8:38977606-38977628 TGTTAAGCTTTGAGCTGGAATGG + Intronic
1039685922 8:39801762-39801784 TGTCAGGATTAGACCTAGAGAGG + Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG + Intronic
1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG + Intergenic
1059552166 9:115240013-115240035 TGTTAGGCTTAGGAAAGGATGGG + Intronic
1059598818 9:115753496-115753518 TGTTCTGCTTAGAAATGCAGAGG + Intergenic
1060766272 9:126296807-126296829 AGAGAGGCTTAGAACTGGAGTGG - Intergenic
1061937496 9:133866239-133866261 TACTAGGCTTAGAACTAGAAAGG - Intronic
1188929563 X:36089726-36089748 TGCTAGGCTTAATATTGGAGTGG + Intronic
1190765665 X:53473637-53473659 AGTCAGGGTTGGAACTGGAGAGG + Intergenic
1194666035 X:96678581-96678603 TGTGAGGATTGGAACTGGAGTGG - Intergenic
1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic