ID: 1165496133

View in Genome Browser
Species Human (GRCh38)
Location 19:36152665-36152687
Sequence GTACCGCTTTGGGCTCCGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165496133_1165496141 5 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496141 19:36152693-36152715 AATACATTTTTGCAGATTTTTGG 0: 1
1: 0
2: 4
3: 57
4: 649
1165496133_1165496144 20 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1165496133_1165496142 18 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496142 19:36152706-36152728 AGATTTTTGGAGATTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1165496133_1165496143 19 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496143 19:36152707-36152729 GATTTTTGGAGATTTCCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1165496133_1165496145 21 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496145 19:36152709-36152731 TTTTTGGAGATTTCCGCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165496133 Original CRISPR GTACCGCTTTGGGCTCCGGT GGG (reversed) Exonic