ID: 1165496133

View in Genome Browser
Species Human (GRCh38)
Location 19:36152665-36152687
Sequence GTACCGCTTTGGGCTCCGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165496133_1165496143 19 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496143 19:36152707-36152729 GATTTTTGGAGATTTCCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1165496133_1165496142 18 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496142 19:36152706-36152728 AGATTTTTGGAGATTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1165496133_1165496145 21 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496145 19:36152709-36152731 TTTTTGGAGATTTCCGCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1165496133_1165496141 5 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496141 19:36152693-36152715 AATACATTTTTGCAGATTTTTGG 0: 1
1: 0
2: 4
3: 57
4: 649
1165496133_1165496144 20 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165496133 Original CRISPR GTACCGCTTTGGGCTCCGGT GGG (reversed) Exonic
904006305 1:27365023-27365045 GTTCTGCTTTGGGCTTCAGTCGG + Intronic
908790059 1:67772302-67772324 GCACCACTTTGGGATCTGGTGGG - Intronic
910674448 1:89802554-89802576 CTAGCGCTGTGGGCTCTGGTAGG - Intronic
922929504 1:229377641-229377663 GTGCCGCCTTCGGCTGCGGTTGG - Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081109824 11:39121142-39121164 GTGCTGCTTTGGGCTCTGGCAGG + Intergenic
1081621675 11:44622475-44622497 GTTGCTCTTTGGGCTCCCGTGGG + Intergenic
1084674948 11:70628852-70628874 GTACTGCTGTGGGCTCTGGCTGG + Intronic
1089346649 11:117795746-117795768 GTATCGCAGTGGGCTCCGGCAGG + Intronic
1095703646 12:45216130-45216152 CTCCGGCTCTGGGCTCCGGTCGG + Exonic
1103834026 12:123804702-123804724 GTTCTGCTTTGGGCTGAGGTTGG + Intronic
1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG + Intergenic
1114083530 14:19220628-19220650 GTTCAGCTCTGGGCTCCCGTGGG + Intergenic
1120655768 14:87188256-87188278 GTACCGCTTTGCACTCCGCCAGG - Intergenic
1126436957 15:48646099-48646121 GAACAGCTTTCTGCTCCGGTAGG - Intergenic
1139018651 16:62721047-62721069 GTATCTCTTTAGGCTCCTGTTGG + Intergenic
1144777887 17:17793928-17793950 GTACTGCTCTGGGGTCCGGACGG - Exonic
1148085733 17:44992818-44992840 GTGCTGCTTTGGGCTCCCCTAGG - Intergenic
1165496133 19:36152665-36152687 GTACCGCTTTGGGCTCCGGTGGG - Exonic
938493055 2:131776004-131776026 GTTCAGCTCTGGGCTCCTGTGGG - Intergenic
946460412 2:219863707-219863729 ATACCTCTTTTGGCTCCAGTAGG - Intergenic
1179162021 21:38906735-38906757 GGACCGCTCAGGGCTACGGTGGG - Intergenic
1180294445 22:10872639-10872661 GTTCAGCTCTGGGCTCCCGTGGG - Intergenic
1180497251 22:15902053-15902075 GTTCAGCTCTGGGCTCCCGTGGG - Intergenic
1182921987 22:34088711-34088733 GTAGCGCTCTGGGCTCCTGTGGG - Intergenic
1183965211 22:41437383-41437405 GTACAGCCTTGGGCTCCAGGCGG + Exonic
966324669 3:178740706-178740728 GTACCACTTTCTGCTTCGGTGGG + Intronic
1038176106 8:25183777-25183799 GAACCGCCTTGGGCTCCAGGTGG - Intergenic
1057739971 9:97702697-97702719 GTATCTCTCTGGGCTCAGGTAGG + Intergenic
1192538599 X:71949605-71949627 GCACCCCTTTGGGCTGTGGTGGG - Intergenic
1197122124 X:122905780-122905802 GTACCGCTTCTGCCCCCGGTTGG - Intergenic