ID: 1165496141

View in Genome Browser
Species Human (GRCh38)
Location 19:36152693-36152715
Sequence AATACATTTTTGCAGATTTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 649}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165496138_1165496141 -5 Left 1165496138 19:36152675-36152697 CCCAAAGCGGTACCAGGGAATAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1165496141 19:36152693-36152715 AATACATTTTTGCAGATTTTTGG 0: 1
1: 0
2: 4
3: 57
4: 649
1165496133_1165496141 5 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496141 19:36152693-36152715 AATACATTTTTGCAGATTTTTGG 0: 1
1: 0
2: 4
3: 57
4: 649
1165496135_1165496141 1 Left 1165496135 19:36152669-36152691 CCGGAGCCCAAAGCGGTACCAGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1165496141 19:36152693-36152715 AATACATTTTTGCAGATTTTTGG 0: 1
1: 0
2: 4
3: 57
4: 649
1165496134_1165496141 4 Left 1165496134 19:36152666-36152688 CCACCGGAGCCCAAAGCGGTACC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1165496141 19:36152693-36152715 AATACATTTTTGCAGATTTTTGG 0: 1
1: 0
2: 4
3: 57
4: 649
1165496139_1165496141 -6 Left 1165496139 19:36152676-36152698 CCAAAGCGGTACCAGGGAATACA 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1165496141 19:36152693-36152715 AATACATTTTTGCAGATTTTTGG 0: 1
1: 0
2: 4
3: 57
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165496141 Original CRISPR AATACATTTTTGCAGATTTT TGG Exonic