ID: 1165496144

View in Genome Browser
Species Human (GRCh38)
Location 19:36152708-36152730
Sequence ATTTTTGGAGATTTCCGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 36}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165496139_1165496144 9 Left 1165496139 19:36152676-36152698 CCAAAGCGGTACCAGGGAATACA 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1165496134_1165496144 19 Left 1165496134 19:36152666-36152688 CCACCGGAGCCCAAAGCGGTACC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1165496135_1165496144 16 Left 1165496135 19:36152669-36152691 CCGGAGCCCAAAGCGGTACCAGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1165496140_1165496144 -2 Left 1165496140 19:36152687-36152709 CCAGGGAATACATTTTTGCAGAT 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1165496138_1165496144 10 Left 1165496138 19:36152675-36152697 CCCAAAGCGGTACCAGGGAATAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1165496133_1165496144 20 Left 1165496133 19:36152665-36152687 CCCACCGGAGCCCAAAGCGGTAC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165496144 19:36152708-36152730 ATTTTTGGAGATTTCCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165496144 Original CRISPR ATTTTTGGAGATTTCCGCCG GGG Exonic