ID: 1165498733

View in Genome Browser
Species Human (GRCh38)
Location 19:36170770-36170792
Sequence GCGAGTGTAGAATGTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165498730_1165498733 23 Left 1165498730 19:36170724-36170746 CCGGCCACGCAGTTCAGAACAAT No data
Right 1165498733 19:36170770-36170792 GCGAGTGTAGAATGTGTGGATGG No data
1165498729_1165498733 24 Left 1165498729 19:36170723-36170745 CCCGGCCACGCAGTTCAGAACAA No data
Right 1165498733 19:36170770-36170792 GCGAGTGTAGAATGTGTGGATGG No data
1165498731_1165498733 19 Left 1165498731 19:36170728-36170750 CCACGCAGTTCAGAACAATACTT No data
Right 1165498733 19:36170770-36170792 GCGAGTGTAGAATGTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165498733 Original CRISPR GCGAGTGTAGAATGTGTGGA TGG Intergenic
No off target data available for this crispr