ID: 1165510966

View in Genome Browser
Species Human (GRCh38)
Location 19:36266510-36266532
Sequence CGGCGGTGGCGCGCTTGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165510966_1165510982 30 Left 1165510966 19:36266510-36266532 CCGCCGCAAGCGCGCCACCGCCG No data
Right 1165510982 19:36266563-36266585 GTGTCGCCGCCATTTTTTAAAGG No data
1165510966_1165510969 -8 Left 1165510966 19:36266510-36266532 CCGCCGCAAGCGCGCCACCGCCG No data
Right 1165510969 19:36266525-36266547 CACCGCCGCCACCGCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165510966 Original CRISPR CGGCGGTGGCGCGCTTGCGG CGG (reversed) Intergenic
No off target data available for this crispr