ID: 1165511157

View in Genome Browser
Species Human (GRCh38)
Location 19:36267476-36267498
Sequence GGGGCTCATTGTCCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165511151_1165511157 2 Left 1165511151 19:36267451-36267473 CCCAACCAAGGACGAAGGACTCA No data
Right 1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG No data
1165511154_1165511157 -3 Left 1165511154 19:36267456-36267478 CCAAGGACGAAGGACTCAGAGGG No data
Right 1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG No data
1165511152_1165511157 1 Left 1165511152 19:36267452-36267474 CCAACCAAGGACGAAGGACTCAG No data
Right 1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG No data
1165511150_1165511157 3 Left 1165511150 19:36267450-36267472 CCCCAACCAAGGACGAAGGACTC No data
Right 1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG No data
1165511147_1165511157 16 Left 1165511147 19:36267437-36267459 CCAGACGAACACACCCCAACCAA No data
Right 1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165511157 Original CRISPR GGGGCTCATTGTCCACCAGC AGG Intergenic
No off target data available for this crispr