ID: 1165511312

View in Genome Browser
Species Human (GRCh38)
Location 19:36268221-36268243
Sequence CCCCCACCCCGCCACGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165511312_1165511322 0 Left 1165511312 19:36268221-36268243 CCTACCCCGTGGCGGGGTGGGGG No data
Right 1165511322 19:36268244-36268266 TGGGAGTGGGGTGAAATTTGTGG No data
1165511312_1165511325 24 Left 1165511312 19:36268221-36268243 CCTACCCCGTGGCGGGGTGGGGG No data
Right 1165511325 19:36268268-36268290 AACCTCTCGGCCCCTCTGGCAGG No data
1165511312_1165511323 11 Left 1165511312 19:36268221-36268243 CCTACCCCGTGGCGGGGTGGGGG No data
Right 1165511323 19:36268255-36268277 TGAAATTTGTGGAAACCTCTCGG No data
1165511312_1165511324 20 Left 1165511312 19:36268221-36268243 CCTACCCCGTGGCGGGGTGGGGG No data
Right 1165511324 19:36268264-36268286 TGGAAACCTCTCGGCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165511312 Original CRISPR CCCCCACCCCGCCACGGGGT AGG (reversed) Intergenic
No off target data available for this crispr