ID: 1165511426

View in Genome Browser
Species Human (GRCh38)
Location 19:36268737-36268759
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165511426_1165511432 -1 Left 1165511426 19:36268737-36268759 CCATTCCCGATCACCCGCTGGGA No data
Right 1165511432 19:36268759-36268781 ATCCATCATCGGACCCCAAGAGG No data
1165511426_1165511437 19 Left 1165511426 19:36268737-36268759 CCATTCCCGATCACCCGCTGGGA No data
Right 1165511437 19:36268779-36268801 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165511426 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr