ID: 1165511974

View in Genome Browser
Species Human (GRCh38)
Location 19:36271260-36271282
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165511974_1165511985 19 Left 1165511974 19:36271260-36271282 CCATTCCCGATCACCCGCTGGGA No data
Right 1165511985 19:36271302-36271324 AGGAGTCCGCGCAGCCCAGCCGG No data
1165511974_1165511980 -1 Left 1165511974 19:36271260-36271282 CCATTCCCGATCACCCGCTGGGA No data
Right 1165511980 19:36271282-36271304 ATCCATCATCGGACCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165511974 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr