ID: 1165513629

View in Genome Browser
Species Human (GRCh38)
Location 19:36278857-36278879
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165513629_1165513635 -1 Left 1165513629 19:36278857-36278879 CCATTCCCGATCACCCGCTGGGA No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513629_1165513640 19 Left 1165513629 19:36278857-36278879 CCATTCCCGATCACCCGCTGGGA No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165513629 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr