ID: 1165513635

View in Genome Browser
Species Human (GRCh38)
Location 19:36278879-36278901
Sequence ATCCATCATCGGACCCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165513630_1165513635 -6 Left 1165513630 19:36278862-36278884 CCCGATCACCCGCTGGGATCCAT No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513620_1165513635 26 Left 1165513620 19:36278830-36278852 CCCTTTCCGCCTCACTGCATTGG No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513629_1165513635 -1 Left 1165513629 19:36278857-36278879 CCATTCCCGATCACCCGCTGGGA No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513622_1165513635 25 Left 1165513622 19:36278831-36278853 CCTTTCCGCCTCACTGCATTGGA No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513627_1165513635 0 Left 1165513627 19:36278856-36278878 CCCATTCCCGATCACCCGCTGGG No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513625_1165513635 1 Left 1165513625 19:36278855-36278877 CCCCATTCCCGATCACCCGCTGG No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513624_1165513635 17 Left 1165513624 19:36278839-36278861 CCTCACTGCATTGGAACCCCATT No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513623_1165513635 20 Left 1165513623 19:36278836-36278858 CCGCCTCACTGCATTGGAACCCC No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data
1165513631_1165513635 -7 Left 1165513631 19:36278863-36278885 CCGATCACCCGCTGGGATCCATC No data
Right 1165513635 19:36278879-36278901 ATCCATCATCGGACCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165513635 Original CRISPR ATCCATCATCGGACCCCAAG AGG Intergenic