ID: 1165513640

View in Genome Browser
Species Human (GRCh38)
Location 19:36278899-36278921
Sequence AGGAGTCCGCGCAGCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165513625_1165513640 21 Left 1165513625 19:36278855-36278877 CCCCATTCCCGATCACCCGCTGG No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data
1165513633_1165513640 6 Left 1165513633 19:36278870-36278892 CCCGCTGGGATCCATCATCGGAC No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data
1165513634_1165513640 5 Left 1165513634 19:36278871-36278893 CCGCTGGGATCCATCATCGGACC No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data
1165513636_1165513640 -5 Left 1165513636 19:36278881-36278903 CCATCATCGGACCCCAAGAGGAG No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data
1165513631_1165513640 13 Left 1165513631 19:36278863-36278885 CCGATCACCCGCTGGGATCCATC No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data
1165513629_1165513640 19 Left 1165513629 19:36278857-36278879 CCATTCCCGATCACCCGCTGGGA No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data
1165513627_1165513640 20 Left 1165513627 19:36278856-36278878 CCCATTCCCGATCACCCGCTGGG No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data
1165513630_1165513640 14 Left 1165513630 19:36278862-36278884 CCCGATCACCCGCTGGGATCCAT No data
Right 1165513640 19:36278899-36278921 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165513640 Original CRISPR AGGAGTCCGCGCAGCCCAGC CGG Intergenic