ID: 1165514731

View in Genome Browser
Species Human (GRCh38)
Location 19:36283928-36283950
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165514731_1165514742 19 Left 1165514731 19:36283928-36283950 CCATTCCCGATCACCCGCTGGGA No data
Right 1165514742 19:36283970-36283992 AGGAGTCCGCGCAGCCCAGCCGG No data
1165514731_1165514737 -1 Left 1165514731 19:36283928-36283950 CCATTCCCGATCACCCGCTGGGA No data
Right 1165514737 19:36283950-36283972 ATCCATCATCGGACCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165514731 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr