ID: 1165515283

View in Genome Browser
Species Human (GRCh38)
Location 19:36286461-36286483
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165515283_1165515289 -1 Left 1165515283 19:36286461-36286483 CCATTCCCGATCACCCGCTGGGA No data
Right 1165515289 19:36286483-36286505 ATCCATCATCGGACCCCAAGAGG No data
1165515283_1165515294 19 Left 1165515283 19:36286461-36286483 CCATTCCCGATCACCCGCTGGGA No data
Right 1165515294 19:36286503-36286525 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165515283 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr