ID: 1165515833

View in Genome Browser
Species Human (GRCh38)
Location 19:36288997-36289019
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165515833_1165515844 19 Left 1165515833 19:36288997-36289019 CCATTCCCGATCACCCGCTGGGA No data
Right 1165515844 19:36289039-36289061 AGGAGTCCGCGCAGCCCAGCCGG No data
1165515833_1165515839 -1 Left 1165515833 19:36288997-36289019 CCATTCCCGATCACCCGCTGGGA No data
Right 1165515839 19:36289019-36289041 ATCCATCATCGGACCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165515833 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr